全 文 ：Gamma-aminobutyric acid mediates nicotine biosynthesis in tobacco
under flooding stress*
Xiaoming Zhang a, b, Hua-ming Lin a, Hong Hu a, Xiangyang Hu a, *, Liwei Hu c, **
a Germplasm Bank of Wild Species in Southwest China, Kunming Institute of Botany, Chinese Academy of Sciences, Kunming, 650201, China
b University of Chinese Academy of Sciences, Beijing, 100049, China
c Laboratory of Tobacco Agriculture, Zhengzhou Tobacco Research Institute of CNTC, Zhengzhou, 450001, China
a r t i c l e i n f o
Article history:
Received 11 May 2015
Received in revised form
23 June 2015
Accepted 23 June 2015
Available online 20 May 2016
Keywords:
Flooding
Gamma-aminobutyric acid
Nicotine
Tobacco
a b s t r a c t
Gamma-aminobutyric acid (GABA) is a four-carbon non-protein amino acid conserved from bacteria to
plants and vertebrates. Increasing evidence supports a regulatory role for GABA in plant development
and the plants response to environmental stress. The biosynthesis of nicotine, the main economically
important metabolite in tobacco, is tightly regulated. GABA has not hitherto been reported to function in
nicotine biosynthesis. Here we report that water flooding treatment (hypoxia) markedly induced the
accumulation of GABA and stimulated nicotine biosynthesis. Suppressing GABA accumulation by treat-
ment with glutamate decarboxylase inhibitor impaired flooding-induced nicotine biosynthesis, while
exogenous GABA application directly induced nicotine biosynthesis. Based on these results, we propose
that GABA triggers nicotine biosynthesis in tobacco seedlings subjected to flooding. Our results provide
insight into the molecular mechanism of nicotine biosynthesis in tobacco plants exposed to environ-
mental stress.
Copyright © 2016 Kunming Institute of Botany, Chinese Academy of Sciences. Publishing services by
Elsevier B.V. on behalf of KeAi Communications Co., Ltd. This is an open access article under the CC BY-
NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Water flooding, or hypoxia, is a common form of environmental
stress that reduces crop yields. Global warming has resulted in an
increase in flooding events (Morard et al., 2004; Bailey-Serres and
Voesenek, 2008). Short-term exposure to flooding can cause
physiological changes in plants, such as a reduction in oxidative
phosphorylation, a switch to anaerobic respiration, a reduction in
nucleoside triphosphates, and an increase in the ratio of NADH to
NADþ. Moreover, hypoxia perturbs normal physiological meta-
bolism in plants by reducing the amount of available energy (Li
et al., 2012; Wang et al., 2014). However, the mechanism by
which hypoxia influences physiological processes in plants remains
poorly understood.
The four-carbon non-protein amino acid, gamma-aminobutyric
acid (GABA), is an important compound in most prokaryotic and
eukaryotic organisms (Bouche and Fromm, 2004; Roberts, 2007;
Fait et al., 2008). GABA plays a dual role in regulating the C:N bal-
ance and nitrogen metabolism, as well as being involved in many
physiological processes, such as carbon flux in the tricarboxylic acid
(TCA) cycle and the antioxidant effect. Furthermore, GABA acts as
an important signal that triggers a series of downstream responses,
such as cold or salt stress tolerance, regulates cytoplasmic pH, and
controls programmed cell death (Kinnersley and Turano, 2000;
Ronald et al., 2003). In plants, GABA is generated via glutamic
acid decarboxylation or polyamine degradation (Yang et al., 2013;
Ford et al., 1996). GABA is mainly metabolized through a short
pathway composed of three enzymes, namely glutamate decar-
boxylase (GAD), the mitochondrial enzyme GABA transaminase
(GAD-T), and succinic semialdehyde dehydrogenase (SSADH). The
GABA biosynthesis pathway is illustrated in Fig. 1. A previous study
showed that exogenous GABA alleviated injury resulting from
hypoxia-induced stress in melons (Fan et al., 2015); however, the
details underlying this mechanism remain largely unknown.
Tobacco (Nicotiana tabacum) generates an array of alkaloids that
play essential roles in the plant defense response against herbivore
and insect attack (Kessler and Baldwin, 2002; Steppuhn et al.,
2004). Nicotine constitutes approximately 0.6e3% of the tobacco
* Funding: Major Science and Technology Program (110201101003-TS-03, TS-02-
20110014, 2011YN02 and 2011YN03).
* Corresponding author.
** Corresponding author.
E-mail addresses: zhangxiaoming@mail.kib.ac.cn (X.M. Zhang), huxiangyang@
mail.kib.ac.cn (X.Y. Hu), liwei.hu@gmail.com (L.W. Hu).
Peer review under responsibility of Editorial Office of Plant Diversity.
Contents lists available at ScienceDirect
Plant Diversity
journal homepage: http: / /www.keaipubl ishing.com/en/ journals /plant-diversi ty /
ht tp: / / journal .k ib.ac.cn
http://dx.doi.org/10.1016/j.pld.2016.05.004
2468-2659/Copyright © 2016 Kunming Institute of Botany, Chinese Academy of Sciences. Publishing services by Elsevier B.V. on behalf of KeAi Communications Co., Ltd. This
is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Plant Diversity 38 (2016) 53e58
(N. tabacum L.) leaf dry weight and is themain alkaloid produced by
cultivated tobacco. Nicotine is synthesized in the root from orni-
thine and arginine by way of putrescine (Leete, 1980). Putrescine is
either metabolized to higher polyamines, such as spermidine and
spermine, or conjugated with cinnamic acid derivatives or fatty
acids in all higher plants; however, it is also converted into N-
methylputrescine in plants that produce nicotine or tropane alka-
loids (Smith, 1981). Thus, putrescine N-methyltransferase (PMT; EC
2.1.1.53) participates in the first committed step of alkaloid
biosynthesis. N-Methylputrescine is then oxidized by a diamine
oxidase (EC1.4.3.6) and cyclized spontaneously to the l-methyl-A-
pyrrolinium cation, which is condensed with nicotinic acid or its
derivative (Hibi et al., 1992; Hashimoto et al., 1993). Quinolinic acid
phosphoribosyltransferase (QAPRT; EC2.4.2.19) serves as the entry
point enzyme in the pyridine nucleotide cycle, which generates
nicotinic acid. After biosynthesis in the tobacco root, nicotine is
translocated to the leaf via the xylem and then stored in the leaf
vacuole with the help of a tonoplast-localized transporter. Nicotine
can be demethylated in both leaves and roots, but is primarily
demethylated in senescing leaves (Chou and Kutchan, 1998). The
accumulation of nicotine in tobacco is affected by environmental
factors, cultural (agricultural) practices, and plant hormone levels.
For example, the application of nitrogen fertilizer or jasmonic acid
markedly increases nicotine biosynthesis (Shoji et al., 2000;
Facchini, 2006; Paschold et al., 2007; Shoji et al., 2008). A previ-
ous study in vertebrates examined the effect of nicotine on the
spontaneous release of GABA from nerve terminals in the chick
lateral spiriform nucleus (Zhu and Chiappinelli, 2002). But the
relationship between nicotine biosynthesis and GABA has not been
reported in tobacco before. In this study, we found that flooding
treatment markedly induced the accumulation of nicotine and
promoted the generation of GABA. Further experiments showed
that GABA triggers nicotine biosynthesis under flooding stress. Our
study provides new insights into the molecular regulatory mech-
anism underlying nicotine biosynthesis in tobacco.
1. Materials and methods
1.1. Plant materials
Sterilized tobacco (N. tabacum) seeds were germinated and
grown to seedlings under continuous illumination on half-strength
Gamborg B5 medium solidified with 2% (W/V) gellan gum and
supplemented with 0.3% sucrose at 24 C. Two-week-old plants
were transferred to perlite saturated with half-strength Gamborg
B5medium, and grown for another twoweeks in the greenhouse at
24 C before flooding treatment (Niroula et al., 2012). For flooding
treatment, the 4-week-old seedlings were fully immersed in water
Fig. 1. The g-aminobutyric acid (GABA) shunt metabolic pathway and its regulation in plants. The glutamine-synthetase/glutamate-synthase (GS/GOGAT) cycle is the principal
nitrogen assimilation pathway into glutamate and amino acids in plants. The glutamate dehydrogenase (GDH) is thought to function primarily in glutamate catabolism but can also
function in the opposite direction. The GABA shunt is composed of three enzymes (purple). Glutamate decarboxylase (GAD) is a cytosolic enzyme regulated (green) by the
Ca2þecalmodulin (CaM) complex, which catalyses the irreversible decarboxylation of glutamate to produce GABA. GABA is transported into the mitochondria, where it is converted
into succinic semialdehyde by GABA transaminases using either a-ketoglutarate (by GABA-TK) or pyruvate (by GABA-TP) as amino acid acceptors. Succinic semialdehyde is then
reduced by succinic semialdehyde dehydrogenase (SSADH) to form succinate, which enters the tricarboxylic acid (TCA) cycle.
X.M. Zhang et al. / Plant Diversity 38 (2016) 53e5854
for the indicated periods, as previously described (Niroula et al.,
2012). For GABA treatment, 2-week-old tobacco plants were
transferred to perlite saturated with half-strength Gamborg B5
medium containing the indicated concentration of GABA.
1.2. Nicotine content measurement
The nicotine content was measured as previously described
(Shoji et al., 2008). After exposure to various treatments, 0.5 g of
tobacco roots was collected, frozen in liquid nitrogen, lyophilized,
homogenized, and then soaked in 4 mL of 0.1 M H2SO4. The ho-
mogenate was sonicated for 60 min and centrifuged at 2000 g for
15 min. The supernatant was neutralized by adding 0.4 mL 25%
NH4OH. The mixture was loaded onto an Extrelut-1 column and
eluted with 6 mL of chloroform. The eluent was dried at 37 C. The
dry residues were dissolved in ethanol and analyzed by GC/MS
chromatography. The chromatography column temperature was
held at 100 C for 10 min, and then increased to 260 C over a 35-
min period, at a gradient of 8 C/min. Each peak was assigned and
calibrated with authentic standards, including nicotine.
1.3. Real-time quantitative PCR analysis
Total RNAwas isolated from tobacco seedlings after exposure to
different treatments using a Qiagen Total RNA Isolation Kit (Qia-
gen). After total RNA was digested with DNase I (Fermentas),
reverse transcription was carried out according to the manufac-
turers protocol (Fermentas). One microgram of total RNAwas used
for cDNA synthesis. mRNAs were then converted into cDNAs using
M-MLV reverse transcriptase (Fermentas) with an Oligo (dT)18
primer. PCR was performed as described (Wang et al., 2008). For
quantification, 10 ml of 2 X PreMix ExTaq (Takara) plus SYBR Green
was used for a 20-mL qPCR reaction. The PCR program consisted of
one cycle (95 C, 3 min), 45 cycles (95 C, 10 s; 60 C, 10 s; 72 C,
10 s), and one cycle (72 C, 5 min), followed by a melting curve
program (55e90 C in 1 C increments). Normalization was ach-
ieved using ACT2 amplification as a constitutive control. Three
technical repeats were performed for each reaction. Two or three
biological repeats were conducted and one representative biolog-
ical repeat was shown. The primer sequences used in this study are
as follows:
For NtADC: Forward primer: ctttggttgcaaggaagctc, reverse
primer: cttcttcaccacacgaaca; For NtODC: Forward primer: acgg-
caccagaaaagtcatc, reverse primer: gacggatatttgggagagca; For
NtPMT: Forward primer: tatgcacacaggctgaaagc, reverse primer:
agtcaacttctggcccttca; For NtMPO: Forward primer: acagtgaggct-
gatgctcct, reverse primer: atcgacccctcctcttgtct; and For NtACTIN2:
Forward primer: caggaatggttaaggctgga, reverse primer:
ccatatcgtcccagttgctt.
1.4. GABA content and GAD activity determination
GABA content was determined as previously reported (Renault
et al., 2010). Briefly, the sample (0.3e0.5 g) was pulverized in
liquid nitrogen immediately after sample collection, and, after
evaporation of the liquid nitrogen, was extracted with 5 mL of 100%
methanol to inactivate the enzyme. Subsequently, 10 mL of chlo-
roform and 5 mL of water were added to the samples while stirring
and the samples were centrifuged at 2800 g for 10 min to separate
the aqueous and organic phases. The GABA-containing aqueous
phase was removed, dried, dissolved in 10 mM TriseHCl buffer (pH
8.0), and passed through an AG 50W resin column (Bio-RAD). GABA
was eluted with 4 N NH4OH, and the eluents from 2 to 6 mL in-
clusive was collected, dried, and dissolved in 0.1 M potassium
pyrophosphate buffer (pH 8.6). The GABA content was analyzed
using GABase (Sigma).
To measure GAD activity, protein extraction was performed in
extraction buffer containing 100 mM TriseHCl (pH 7.5), 1 mM
EDTA, 1% (v/v) protease inhibitor cocktail (Sigma, #P9599), and 10%
(v/v) glycerol. Enzyme assays were performed with 15 ml of protein
extract (~30 mg of protein) in a reaction buffer containing 150 mM
potassium phosphate (pH 5.8), 0.1 mM PLP, and 20 mM L-glutamate
in a final volume of 150 ml. Control assays were conducted as pre-
viously described. After incubation at 30 C for 60 min, samples
were heated at 97 C for 7 min to stop the reaction. GAD activity
was evaluated by quantifying the amount of GABA produced by
enzymatic assays using GABase (Sigma). GABase assays were per-
formed using 20 ml of GAD in an assay mix containing 75 mM po-
tassium pyrophosphate (pH 8.6), 3.3 mM 2-mercaptoethanol,
1.25 mM b-NADPþ, 5 mM 2-ketoglutarate, and 0.02 units of Pseu-
domonas fluorescens GABase (Sigma, #G7509) in a final volume of
200 ml. The increase in absorbance at OD340 was recorded using a
96-well microplate reader. Protein concentrations were deter-
mined by the Bradford method with bovine serum albumin as
standard.
2. Results
2.1. Flooding treatment promotes GABA production and GAD
activity under flooding
To understand the role of GABA in tobacco under flooding stress,
we firstly exposed 2-week-old tobacco seedlings to different pe-
riods of flooding stress and found that flooding markedly induced
the accumulation of GABA, with levels peaking after 48 h of
treatment. By contrast, GABA levels remained low in tobacco
seedlings not subjected to flooding treatment (Fig. 2A). In plants,
GAD is the main enzyme responsible for GABA biosynthesis. We
found that flooding treatment increased GAD activity. These results
suggest that GABA may play an important role in tobacco in
response to flooding treatment.
2.2. Flooding induced nicotine biosynthesis
Different treatments, such as wounding, can induce the
biosynthesis of nicotine (Facchini, 2006). Here we found that
flooding treatment also induced the biosynthesis of nicotine. As
shown in Fig. 3A, flooding gradually induced the accumulation of
nicotine, while the control plant not subjected to flooding did not
exhibit changes in nicotine content. NtADC, NtODC, NtPMT, and
NtMPO are the main genes responsible for nicotine biosynthesis in
tobacco. Here we found that flooding treatment could increase the
transcription of these genes, with their levels peaking after 48 h or
72 h of flooding (Fig. 3B). These results are in agreement with the
observed increase in nicotine production following flooding, and
suggest that these genes mediate the flooding-induced increase in
nicotine biosynthesis.
2.3. Suppressing GABA biosynthesis reduces nicotine biosynthesis
under flooding treatment
Prompted by the findings that flooding promotes GABA accu-
mulation and nicotine biosynthesis, we next examined the possible
connection between GABA and nicotine biosynthesis under flood-
ing. We treated tobacco seedlings with different GAD inhibitors,
MPA (3-mercaptopropionate) and DTNB (dithio-bis-nitrobenzoic
acid). We found that both of these inhibitor treatments markedly
suppressed flooding-induced GABA accumulation (Fig. 4). These
data confirm that GABA accumulation depends on GAD activity
X.M. Zhang et al. / Plant Diversity 38 (2016) 53e58 55
during flooding. Furthermore, we found that MPA or DTNB treat-
ment, respectively, also reduced the levels of NtADC, NtODC, NtPMT,
and NtMPO transcript in tobacco seedlings subjected to flooding
stress (Fig. 5A). In agreement with this observation, we found that
MPA or DTNB also suppressed flooding-induced nicotine biosyn-
thesis (Fig. 5B). These data indicate that GABA triggers the tran-
scription of nicotine biosynthesis-related genes and nicotine
biosynthesis under flooding stress.
2.4. Exogenous application of GABA induces nicotine biosynthesis
To further confirm the potential role of GABA in mediating
nicotine biosynthesis, we treated tobacco seedlings with different
concentrations of GABA. As shown in Fig. 6A, we found that con-
centrations of GABA ranging from 1 mM to 50 mM markedly
induced the transcription of NtADC, NtODC, NtPMT, and NtMPO.
Whereas treatment with 5 mM or 10 mM GABA markedly induced
transcription of these genes, the effect was less striking when
plants were treated with 50 mM GABA. Furthermore, GABA treat-
ment also induced nicotine biosynthesis, with a 5 mM treatment
having a greater effect on nicotine biosynthesis than a 10 mM or
50 mM treatment (Fig. 6B). This finding is consistent with the
observation that GABA promotes the transcription of nicotine
biosynthesis-related genes.
3. Discussion
Increasing evidence suggests that GABA plays multiple physi-
ological functions in plants, and is not merely a metabolite
(Bouche and Fromm, 2004; Fait et al., 2008). Previous reports
demonstrated that salt stress and insect attack rapidly induce
GABA accumulation (Ramputh and Bown, 1996; Renault et al.,
2010). In this study, we found that hypoxia of flooding stress
also induces the accumulation of GABA in tobacco seedlings (Fan
et al., 2015). Recently, comparative physiological and proteomic
studies revealed that GABA enhances the tolerance of melon
plants subjected to hypoxia stress (Fan et al., 2015). It is possible
that GABA regulates cytoplasmic pH, sustains nitrogen/carbon
Fig. 2. Flooding treatment promotes GABA accumulation and GAD enzyme activity. Two-week-old tobacco seedlings were exposed to flooding stress, and the GABA content (A) and
GAD activity (B) were measured at the indicated time points. Data represent the means of three replicate experiments (±SE).
Fig. 3. Flooding treatment induces the transcription of nicotine-related genes and promotes nicotine biosynthesis. Two-week-old tobacco seedlings were exposed to flooding stress
and the transcription of nicotine-related genes (NtADC, NtODC, NtPMT, and NtMPO; A); and the levels of nicotine (B) were measured at the indicated time points. Data represent the
means of three replicate experiments (±SE).
Fig. 4. Suppressing GAD activity reduces nicotine biosynthesis. Two-week-old tobacco
seedlings were exposed to flooding stress with or without 1 mM MPA or 10 mM DTNB
and the nicotine content was measured at the indicated time points. Data represent
the means of three replicate experiments (±SE). Different letters indicate significant
differences according to Tukeys test (p < 0.05).
X.M. Zhang et al. / Plant Diversity 38 (2016) 53e5856
fluxes, the TCA cycle, or increases antioxidant stress ability to
improve tobacco tolerance to flooding stress (Bouche and Fromm,
2004; Valderrama et al., 2006; Fait et al., 2008). Bouche et al.
report that GABA catabolism prevents reactive oxygen species
generations and suppresses cell death, indicating that GABA re-
duces ROS damage to enhance tobacco seedling survival during
flooding (Bouche and Fromm, 2004). In plants and animals, GABA
is mainly catabolized through a short pathway composed of three
enzymes, i.e., glutamate decarboxylase (GAD), the mitochondrial
enzyme GABA transaminase (GAD-T), and succinic semialdehyde
dehydrogenase (SSADH) (Fait et al., 2008). In Arabidopsis, the GAD
gene family consists of five members (Renault et al., 2010). Here
we found that the tobacco GAD enzyme is also the main enzyme
responsible for GABA biosynthesis under flooding stress, because
suppressing GAD enzyme activity by MPA or DTNB also markedly
reduced GABA accumulation under flooding stress.
Nicotine is the major economically important metabolite in to-
bacco. Many agricultural practices, such as removing the shoot apex
or applying nitrogen fertilizer, have been used to induce nicotine
biosynthesis (Xi et al., 2005, 2008; Wang et al., 2008). We previ-
ously found that high temperatures also induce nicotine biosyn-
thesis (unpublished data). Here, we found that flooding treatment
significantly increases nicotine biosynthesis in tobacco seedlings
primarily through activating the transcriptional levels of genes
associated with nicotine biosynthesis, including NtADC, NtODC,
NtPMT, and NtMPO (Wang and Bennetzen, 2015). We further pre-
sented the following three lines of evidence that GABA mediates
flooding-induced nicotine biosynthesis: 1) flooding stress induced
GABA biosynthesis in tobacco seedlings, in a GAD activity-
dependent manner; 2) suppressing GAD activity with a GAD
inhibitor (MPA or DTNB) also impaired flooding-induced nicotine
biosynthesis in tobacco seedlings, and reduced the levels of NtADC,
NtODC, NtPMT, and NtMPO transcript; and 3) direct application of
exogenous GABA markedly induced the transcription of nicotine
biosynthesis-related genes and promoted nicotine biogenesis. It is
possible that GABA as the signal enhances nicotine biosynthesis
under flooding stress through reactive oxygen species or intracel-
lular redox status, since GABA can affect the intracellular redox
status (Bouche and Fromm, 2004), while the intracellular redox
status could affect multiple genes expression. Thus we propose that
GABA modulates nicotine biosynthesis under flooding by changing
the intracellular redox status, and finally triggering the expression
of nicotine biosynthesis-related genes, including NtADC, NtODC,
NtPMT, and NtMPO.
In conclusion, we provide physiological and biochemical lines of
evidence that GABA plays novel roles in inducing nicotine biosyn-
thesis in tobacco plants subjected to flooding. We found that
flooding promoted the activity of GAD, which catalyzes the syn-
thesis of GABA, and that the resulting GABA induced nicotine
biosynthesis by increasing the transcription of a series of genes
related to nicotine biosynthesis. Our results show that GABA me-
diates the increase in nicotine biosynthesis following exposure to
environmental stress, and provide insight into the molecular
mechanism underlying nicotine biosynthesis in plants subjected to
environmental stress.
Acknowledgments
This work was supported by grants from Major Science and
Technology Program (110201101003-TS-03, TS-02-20110014,
Fig. 5. Suppressing GAD activity reduces the transcription of nicotine-related genes and nicotine biosynthesis. Two-week-old tobacco seedlings were exposed to flooding stress
with or without 1 mM MPA or 10 mM DTNB, and the transcription of nicotine-related genes (NtADC, NtODC, NtPMT and NtMPO; A) and nicotine content (B) were quantified. Data
represent the means of three replicate experiments (±SE). Different letters indicate significant differences according to Tukeys test p < 0.05).
Fig. 6. Exogenous GABA treatment induced the transcription of nicotine-related genes and nicotine biosynthesis. Two-week-old tobacco seedlings were treated with various
concentrations of GABA, and the transcription of nicotine-related genes (NtADC, NtODC, NtPMT and NtMPO; A) and nicotine content (B) were quantified. Data represent the means of
three replicate experiments (±SE). Different letters indicate significant differences according to Tukeys test (p < 0.05).
X.M. Zhang et al. / Plant Diversity 38 (2016) 53e58 57
2011YN02 and 2011YN03). In addition, we thank Yang Qiuyun,
Zhang Wei, Bai Xuegui, Liu Tianmeng, Yin Xianlun (Kunming
Institute of Botany, Chinese Academy of Sciences) and Chen Xiao-
dong (Nanjing University of Science and Technology) for help with
the field tobacco leaf collection in another tobacco project.
References
Bailey-Serres, J., Voesenek, L.A., 2008. Flooding stress: acclimations and genetic
diversity. Annu. Rev. Plant Biol. 59, 313e339.
Bouche, N., Fromm, H., 2004. GABA in plants: just a metabolite? Trends Plant Sci. 9,
110e115.
Chou, W.M., Kutchan, T.M., 1998. Enzymatic oxidations in the biosynthesis of
complex alkaloids. Plant J. 15, 289e300.
Facchini, P.J., 2006. Regulation of alkaloid biosynthesis in plants. Alkaloids Chem.
Biol. 63, 1e44.
Fait, A., Fromm, H., Walter, D., et al., 2008. Highway or byway: the metabolic role of
the GABA shunt in plants. Trends Plant Sci. 13, 14e19.
Fan, L., Wu, X., Tian, Z., et al., 2015. Comparative proteomic analysis of gamma-
aminobutyric acid responses in hypoxia-treated and untreated melon roots.
Phytochemistry 116, 28e37.
Ford, Y.-Y., Ratcliffe, R.G., Robins, R.J., 1996. Phytohormone-induced GABA produc-
tion in transformed root cultures of Datura stramonium: an in vivo 15N NMR
study. J. Exp. Bot. 47 (299), 811e818.
Hashimoto, T., Hibi, N., Yamada, Y., 1993. Subtractive hybridization. Plant Tissue
Cult. Lett. 10, 307e313.
Hibi, N., Fujita, T., Hatano, M., et al., 1992. Putrescine N-methyltransferase in
cultured roots of Hyoscyamus albus. Plant Physiol. 100, 826e835.
Kessler, A., Baldwin, I.T., 2002. Plant responses to insect herbivory: the emerging
molecular analysis. Annu. Rev. Plant Biol. 53, 299e328.
Kinnersley, A.M., Turano, F.J., 2000. g-aminobutyric acid (GABA) and plant re-
sponses to stress. Crit. Rev. Plant Sci. 19, 479e509. http://dx.doi.org/10.1016/
S0735-2689(01)80006-X.
Leete, E., 1980. Alkaloids derived from ornithine, lysine, and nicotinic acid. In:
Bell, E.A., Charlwood, B.V. (Eds.), Encyclopedia of Plant Physiology, New Series,
vol. 8. Springer-Verlag, Berlin, pp. 65e91.
Li, J., Sun, J., Yang, Y., Guo, S., et al., 2012. Identification of hypoxic-responsive
proteins in cucumber roots using a proteomic approach. Plant Physiol. Bio-
chem. 51, 74e80.
Morard, P., Silvestre, J., Lacoste, L., et al., 2004. Nitrate uptake and nitrite release by
tomato roots in response to anoxia. J. Plant Physiol. 161, 855e865.
Niroula, R.K., Pucciariello, C., Ho, V.T., et al., 2012. SUB1A-dependent and -inde-
pendent mechanisms are involved in the flooding tolerance of wild rice species.
Plant J. 72, 282e293.
Paschold, A., Halitschke, R., Baldwin, I.T., 2007. Co(i)-ordinating defenses: NaCOI1
mediates herbivore-induced resistance in Nicotiana attenuata and reveals the
role of herbivore movement in avoiding defenses. Plant J. 51, 79e91.
Ramputh, A.I., Bown, A.W., 1996. Rapid [gamma]-aminobutyric acid synthesis and
the inhibition of the growth and development of oblique-banded leaf-roller
larvae. Plant Physiol. 111, 1349e1352.
Renault, H., Roussel, V., El Amrani, A., et al., 2010. The Arabidopsis pop2-1 mutant
reveals the involvement of GABA transaminase in salt stress tolerance. BMC
Plant Biol. 10, 20.
Roberts, M.R., 2007. Does GABA act as a signal in plants? hints from molecular
studies. Plant Signal Behav. 2, 408e409.
Ronald, W.O., Jordi, C., et al., 2003. Rescue of developing spinal motoneurons from
programmed cell death by the GABAA agonist muscimol acts by blockade of
neuromuscular activity and increased intramuscular nerve branching. Mol. Cell.
Neurosci. 22, 331e343.
Shoji, T., Ogawa, T., Hashimoto, T., 2008. Jasmonate-induced nicotine formation in
tobacco is mediated by tobacco COI1 and JAZ genes. Plant Cell Physiol. 49,
1003e1012.
Shoji, T., Yamada, Y., Hashimoto, T., 2000. Jasmonate induction of putrescine N-
methyltransferase genes in the root of Nicotiana sylvestris. Plant Cell Physiol. 41,
831e839.
Smith, T.A., 1981. Amines. In: Stumpf, P.K., Conn, E.E. (Eds.), The Biochemistry of
Plants, vol. 7. Academic Press, London, pp. 249e268.
Steppuhn, A., Gase, K., Krock, B., et al., 2004. Nicotines defensive function in nature.
PLoS Biol. 2, E217.
Valderrama, R., Corpas, F.J., Carreras, A., et al., 2006. The dehydrogenase-mediated
recycling of NADPH is a key antioxidant system against salt-induced oxidative
stress in olive plants. Plant Cell Environ. 29, 1449e1459.
Wang, C., Fan, L., Gao, H., et al., 2014. Polyamine biosynthesis and degradation are
modulated by exogenous gamma-aminobutyric acid in root-zone hypoxia-
stressed melon roots. Plant Physiol. Biochem. 82, 17e26.
Wang, S.S., Shi, Q.M., Li, W.Q., et al., 2008. Nicotine concentration in leaves of flue-
cured tobacco plants as affected by removal of the shoot apex and lateral buds.
J. Integr. Plant Biol. 50, 958e964.
Wang, X., Bennetzen, J.L., 2015. Current status and prospects for the study of
Nicotiana genomics, genetics, and nicotine biosynthesis genes. Mol. Genet.
Genomics 290, 11e21.
Xi, X., Li, C., Zhang, F., 2008. Tobacco plants can use nitrogen taken up before me-
chanical wounding to synthesize nicotine afterwards. Plant Signal Behav. 3,
87e90.
Xi, X.Y., Li, C.J., Zhang, F.S., 2005. Nitrogen supply after removing the shoot apex
increases the nicotine concentration and nitrogen content of tobacco plants.
Ann. Bot. 96, 793e797.
Yang, R., Guo, Q., Gu, Z., 2013. GABA shunt and polyamine degradation pathway on
g-aminobutyric acid accumulation in germinating fava bean (Vicia faba L.)
under hypoxia. Food Chem. 136 (1), 152e159.
Zhu, P.J., Chiappinelli, V.A., 2002. Nicotinic receptors mediate increased GABA
release in brain through a tetrodotoxin-insensitive mechanism during pro-
longed exposure to nicotine. Neuroscience 115, 137e144.
X.M. Zhang et al. / Plant Diversity 38 (2016) 53e5858