全 文 ：Received 5 Aug. 2003 Accepted 18 Nov. 2003
Supported by the National Natural Science Foundation of China (2001AA222051).
* Current address: Forest Biotechnology Group, Department of Forestry, North Carolina State University, 2500 Partner II Building,
Campus Box 7247, Raleigh, NC 27695.
** Author for correspondence. Tel: +86 (0)10 62552880; Fax: +86 (0)10 62537814; E-mail:.
http://www.chineseplantscience.com
Acta Botanica Sinica
植 物 学 报 2004, 46 (4): 472-479
Identification of an Endothelium-specific Gene GhIAA16
in Cotton (Gossypium hirsutum)
SUO Jin-Feng 1, PU Li 2, LIANG Xiao-E 1*, XUE Yong-Biao 1**
(1. Institute of Genetics and Developmental Biology, The Chinese Academy of Sciences, Beijing 100080, China;
2. College of Life Sciences, Beijing Normal University, Beijing 100875, China)
Abstract: Cotton (Gossypium hirsutum L.) fibers are derived from the outer integument of ovule, while
little is known about cotton ovule development. In order to identify and analyze the expression of genes
associated with cotton ovule development, a cDNA array approach was used to screen for genes with
altered expression in cotton ovule before and after anthesis, and 25 differentially expressed genes were
subsequently identified. Among them, GhIAA16 encodes a predicted polypeptide of 208 amino acids highly
homologous to Arabidopsis IAA16. Molecular analysis revealed that it is a single-copy gene in cotton
genome and specifically expressed in the ovule endothelium. To our knowledge, GhIAA16 is the first
endothelium-specific gene isolated from cotton. Its possible function is discussed during cotton ovule
formation.
Key words: cDNA array; GhIAA16; cotton ovule; endothelium
An angiosperm seed including embryo and endosperm
is surrounded by seed coat, which develops from ou ter
integument of ovule, the female reproductive organ and
therefore is of maternal origin. Important functions of the
seed coat include protecting embryo from biotic and abi-
otic st resses, provid ing nutrients for embryo during its
development as well as water and oxygen during
germination, and delaying germination by controlling the
strength of dormancy (Boesewinkel and Bouman, 1995).
An ovule has a simple but nevertheless highly differen-
tiated structure. The nucellus is the terminal region of the
ovule and is the site of embryo sac formation, which con-
sists of seven cells and four different cell types: three an-
tipodal cells, two synergid cells, one egg cell, and one cen-
t ral cell. Surrounding the nucellus are one o r two
integuments, lateral structures that usually tightly encase
the nucellus. The integuments are not fused at the apex of
the nucellus but have an opening, the micropyle, through
which a pollen tube can gain access to the embryo sac. The
basal part of the ovule is the funiculus, a supporting stalk
that attaches the ovule to the placental region with in the
carpel (Gasser et al., 1998). The innermost cell layer of the
seed coat is also called endothelium. In Arabidopsis, the
seed coat consists of five cell layers: two of them form the
ou ter in tegument and three form the inner integument
(Léon-Kloosterziel et a l., 1994). Genetic analyses indicate
that inner and outer integument development can occur
independently and the late stage embryo sac development
depends on the integuments. In every case in which the
integuments do not enclose the nucellus, an embryo sac
fails to form. So the diploid or sporophytic integument is
indispensable for the formation of the haploid multicellular
embryo sac (Gasser et al., 1998).
Aux/IAA genes are found throughout the plant kingdom
and were first identified because many of them are rapidly
induced as a primary response to auxin (Abel and Theologis,
1996). The Arabidopsis thaliana genome contains at least
29 Aux/IAA genes, many of which were identified because
of their rapid induction after auxin treatment (Liscum and
Reed, 2002). The Aux/IAA genes encode short-lived nuclear
proteins, which have a relative molecular mass of 25–35 kD
and s hare four conserved domains, designed Ⅰ-Ⅳ. Do-
mains Ⅲ and Ⅳ mediate homo- and heterodimerization
between Aux/IAA proteins and heterodimerization with
members of a second large protein family called the auxin-
response facto rs (ARFs), most o f ARFs also contain do-
mains Ⅲ and Ⅳ as well. The ARF proteins are transcription
factors that bind to auxin-response elements (AuxRE) lo-
cated ups tream of auxin-inducible genes (Leyser, 2001).
Domain Ⅱ has been demonstrated to act as a transferable
protein degradat ion signal when fused to luciferas e.
Furthermore, mutations in domain Ⅱ resto red stability to
SUO Jin-Feng et al.: Identification of an Endothelium-specific Gene GhIAA16 in Cotton (Gossypium hirsutum) 473
the luciferase fusion protein. Thus, a rapid turnover of Aux/IAA
proteins is essential for normal auxin response (Tiwari et al., 2001).
Besides Arabidopsis, s everal members of this family
have been found in other species. For example, PS-IAA4/5,
PS-IAA6 in pea and Aux22 and Aux28 in s oybean are ex-
pressed in elongating, d ividing, and different iating cell
types, indicating multiple functions during development
(Ainley et al., 1988; Wong et al., 1996).
Cotton fibers are derived from the outer integument of
ovule. But little is known about cotton ovule development.
In this study, we isolated an IAA gene from cotton homolo-
gous to Arabidopsis IAA16 and named it GhIAA16. Ex-
pressional analysis revealed that GhIAA16’s trans cript is
restricted to the most internal cell layer of the seed coat,
that is, the endothelium. Its poss ible functions in cotton
are discussed.
1 Materials and Methods
1.1 Plant materials
Vegetative and reproductive organs and tissues were
harvested from the allotetraploid cotton species (Gossypium
hirsu tum L. cv . XZ142 and G. hirsutum L. cv . XZ142w)
grown under a 30/21 ℃ day /night temperature regime in
the greenhouse. The XZ142w is a fuzzless-lintless mutant
identified by Zhang and Pan (1991) from the XZ142. Devel-
oping ovules were excised from flower buds or bolls on
various days before/post-anthesis (dpa) relative to the day
of anthesis (0 dpa).
1.2 cDNA array
cDNA lib rary from co tton ovules was const ructed
using SMART cDNA Library Construction Kit (Clontech,
K1051), and were randomly selected and printed from 384-
well plates onto Hybond N+ (Amersham Parmacia Biotech,
UK ) membranes. The cDNA array procedures were carried
out basically as previously described (Bao et a l., 2002).
The high density filters were prepared using the Biomek
2000 HDRT system, and were probed with a-32P-dCTP-la-
belled first strand cDNA. The filters were exposed to X-ray
films (Kodak).
1.3 Semi-quantitative RT-PCR analysis
First-strand cDNA was synthesized from 5 mg total RNA
us ing the SUPERSCRIPT Ⅱ RNase H－ Revers e Tran-
scriptase (Gibco, USA). One tenth of the first strand cDNA
was used as a template in 50 mL PCR reactions. Gene-spe-
cific RT-PCR primers were designed according to the cDNA
s equences and s ynthes ized commercially (Sangon ,
Shanghai, China). Parallel reactions using cotton ubiquitin
primers served to normalize the amount of template added.
The used primers are shown in Table 1.
1.4 Southern and Northern analyses
Genomic DNA was isolated from leaves of G. hirsutum
L. cv. XZ142 and G. h irsu tum L. cv . XZ142w using a
cetyltrimethylammonium bromide (CTAB) extraction method
(Paterson et al., 1993). The DNA (20 mg) was digested, sepa-
rated on 0.8% agarose gel and transferred onto Hybond N+
membrane. Prehybridization, hybridization, and washing of
the b lo t were perfo rmed as recommended by the
manufacturer. Total RNA was extracted from different tis-
sues with the protocol according to RNeasy Plant Mini Kit
(Qiagen , USA). RNA samples were separated on 1.2%
Table 1 Primers used for RT-PCR analysis of genes differentially expressed during cotton ovule development
Clone ID 3 primer 5 primer
ary1 CATTAAAATGAAATATGGTC GGGCTTCGAGGGGGACCC
ary2 CTAATTAACAACAGTATG CATTAAAGCTCAAATGCAACTCC
ary3 CACTTTGGAGCTATCAGT GAGAAGGCCGGAGTGAAAG
ary4 GTTGTACAAGCCCTTGCC AGAAGCGTAAGAAGCGCAAG
ary5 CATAGCAGAACAGGTAAATCCATC TCACTAGATCTCTCATGGC
ary6 CGAGGCGACAAAGGGCTG GAATCAGCGGGGAAAGAAGAC
ary10 CCATAGAACAACAACTGAGAACCG CTCCGCTGCCCGAATTCCC
ary11 GTGAGAAAAGAGAGAGAGAGAG CTGCTTTCTCGTATAGCAGCCTG
ary12 TACTCTTGTTTACATTACAGCTG ATGGGGAGTTCTTGGGGCTG
ary13 CTCCTCTCACACATATGTCGCGC CTTTTACTAGAGGCTAGAGCC
ary14 CTCTTAAAAACCTCTCTCAC GCCTAAAAGTTAAAAGGTAAACAG
ary15 CCAAAGCCACTATACTGTGTGTG GAAGATGGCCCGTACCAAGCAG
ary16 CGGAGAGTAAATTTCCAACAAGG GCAACTGAGAAAAGGCCTC
ary27 CATTCTTATTACCGATACCCGAG GGAGGCTTTGACTAAGGCATG
ary30 GCCGACTTCCCTTGCCTAC GACGGTGGTCATGGAAGTCG
ary31 GCAAGAGCTACAAACGACG ACTCGTGTACATCGCGTGGC
ary32 CACATTGCGTGAGCATCCGC GCAGAACTGGCGATGCGGGATG
ary33 CTACTATATACTACTAGTTAACTTGG GGAACTGAGTATTATCAAAAGAG
ary34 GCCGACTTCCCTTGCCTTAC CGGTCCGACAGCGCGGTC
Acta Botanica Sinica 植物学报 Vol.46 No.4 2004474
agarose/formaldehyde gels and transferred to Hybond N+
membrane, and prehybridization, hybridization and wash-
ing of the blo t were perfo rmed as recommended by the
manufacturer. Probes were labeled with 32P by random prim-
ing using Prime-a-Gene Labeling system (Promega, USA).
The blots were exposed to X-ray films (Kodak).
1.5 In situ RNA hybridization
Digoxygenin-labeled s ense or antisens e RNA probes
were prepared following the manufacturer’s recommenda-
t ion (Boehringer，Mannheim). Tis sue fixation and
embedding, in situ hybridization and signal detection were
essentially performed as described by Lai et al. (2002).
2 Results
2.1 Identification of GhIAA16 expressed in cotton ovule
To iden tify genes involved in cot ton ovule formation,
we took a cDNA array approach to monitoring differential
gene expression of cotton ovules. First strand cDNA probes
reverse-transcribed from total RNAs of the ovules from –3
dpa, 0 dpa and +3 dpa were hybridized with 62 high-density
filters containing 23 000 cDNA clones from the cDNA li-
brary constructed from developing cotton ovules and dif-
ferentially expressed clones were selected. To reduce pos-
sib le false positives caused by the difference of sample
deposit among filters, hybridization was performed twice
with changed filters and on ly those clones that showed
similar express ion patterns in the two hybridizations were
chosen. An image of a portion of cDNA array is shown in
Fig.1.
The hybridization results between different probes were
similar, and mos t of the clones showed no s ign ificant
changes among different probes. Subsequently, a total of
only 25 differentially expres sed cDNA clones were identi-
fied and subcloned into a pBluescrip t Ⅱ SK (+) vector.
Sequencing and homology analyses revealed that 10 of
them are homologous to known genes in the GenBank (Table
2), whereas the rest has no hit.
To confirm the differential expression during cotton ovule
development, they were subject to semi-quantitative RT-
PCR and the results of 13 cDNA sequences are shown in
Fig.2. Most of them displayed the same responsiveness as
detected by the cDNA array and were highly expressed at
the early stage of ovule formation. Among them, ary11 en-
codes a 208 amino acid pro tein highly homologous to
Arabidopsis IAA16 (A tIAA16) (Arab idops is Genome
Initiative, 2000) with 59.4% amino acids identity (Fig.3) and
was therefo re named GhIAA16. Sequence alignment be-
tween AtIAA16 and GhIAA16 revealed that they are iden-
tical in the conserved 4 domains of the IAA family with
some differences in their amino termini (Fig.3A).
To investigate its gene structure, we obtained a genomic
DNA sequence of GhIAA16 of 934 bp corresponding to its
Fig.1. Identification of differential expressed genes during cotton ovule development by using cDNA array. A portion of a filter is shown
here and was hybridized by probes from –3 dpa (upper) and +3 dpa (lower) ovules. Cycles indicate the differentially expressed clones.
SUO Jin-Feng et al.: Identification of an Endothelium-specific Gene GhIAA16 in Cotton (Gossypium hirsutum) 475
cDNA. Three introns with the lengths of 110, 103 and 94 bp
and four exons with the lengths of 236, 182, 109 and 100 bp
were identified, respectively, different from AtIAA16 which
contains four introns with the lengths of 450, 87, 94, and 81
bp and five exons with the lengths of 204, 271, 137, 61, 38
bp (Arabidopsis Genome Initiative, 2000), respectively. Se-
quence comparison showed that the former three introns
are at the same positions between AtIAA16 and GhIAA16,
whereas the last one of AtIAA16 is not present in GhIAA16
(Fig.3B).
2.2 GhIAA16 presents as a single-copy gene in cotton
genome
To examine the o rganizat ion o f GhIAA16 in co tton
genome, DNA blotting analys is was performed using the
coding region of GhIAA16 as a probe (Fig.4). Sing le frag-
ments of 6.0 kb and 8.0 kb were detected in BamHⅠ and
EcoRⅠ-restricted genomic DNA, respect ively, and two
fragments of 3.8 and 2.9 kb were found in the HindⅢ digest.
Table 2 Genes that are differentially expressed during cotton ovule development
Clone ID
Accession number of the
Description E-value
closest hit in database
ary-3 Q42551 Ubiquitin-conjugating enzyme E2 3.1e-14
ary-4 Q42619 Ctp:phosphocholine cytidylyltransferase 3.3e-12
ary-6 O64410 Cytochrome P450 monooxygenase 4.0e-21
ary-11 O24407 Auxin-responsive protein Iaa16 2.7e-07
ary-12 Q9LWP7 Similar To Arabidopsis thaliana chromosome 2 bac clone F4l23 3.8e-05
ary-15 BAA31218 Histone H3 6.4e-56
ary-30 Q9NGQ4 Insecticide resistance-associated Cytochrome P450 (fragment) 0.010
ary-35 AAB97162 Histone H3 3.1e-65
ary-37 Q9AXD9 Mago nashi-like protein 1.2e-70
ary-38 O04263 Immunophilin 1.4e-51
Fig.2. RT-PCR analysis of cotton ovule cDNAs. Total RNA (3 mg) isolated from –3, 0 and +3 dpa ovules and leaves were used to
synthesize cDNA for RT-PCR analysis using gene-specific primers. A cotton ubiquitin cDNA was used to normalize the amount of
templates added in the PCR reactions. Days post anthesis (dpa) are shown at the bottom.
Acta Botanica Sinica 植物学报 Vol.46 No.4 2004476
The two HindⅢ -hybridizing bands were due to the pres-
ence of an internal HindⅢ site of GhIAA16 sequence. Thus,
GhIAA16 occurred as a unique gene in cotton genome. In
addition, we also investigated the genomic organization of
GhIAA16 in a fuzzles s-lin tless (fl) mutan t of cot ton and
detected no difference between the mutant and wild type
(Fig.4).
2.3 GhIAA16 is highly expressed in the endothelium of
ovule
To examine the expression pattern of GhIAA16, North-
ern blotting analysis was performed using RNA from cot-
ton ovules of –3 dpa, 0 dpa, +3 dpa and leaves respectively
(Fig.5). The result showed that GhIAA16 transcripts peaked
at the –3 dpa ovule when cotton fibers are initiated, and no
signal was detected in the leaves , suggesting that it is a
cotton ovule-specific gene (Fig.5).
To further examine its tissue-specific pattern, in situ RNA
hybridization was done with the ovule of 0 dpa. The 5 end
of the gene with 450 bp was used as the probe, because the
3 ends of the IAA family are usually highly conserved. The
result showed that it is specifically expressed in the endot-
helium of the cotton ovule (Fig.6).
3 Discussion
Here, we have isolated a cotton gene GhIAA16 homolo-
gous to Arabidopsis IAA16 and found that it is a single-
copy gene in cotton genome and specifically expressed in
the endothelium of the ovule.
Although genetic control of cotton ovule development
remains unknown, a number of genes have been identified
that are important for the growth and morphogenesis of the
integuments in Arabidopsis (Schneitz et al., 1998). Several
Fig.3. Comp arison of amino acid sequences and gene structures of GhIAA16 and AtIAA16. A. Alignment of predicted polyp eptide
sequences of GhIAA16 and AtIAA16. Identical amino acids are shaded. Dashes are introduced t o maximiz e the alignment. Four
conserved domains are indicated by I-IV, the amphipathic b a a structure are underlined. The arrows with number indicated the location
of intron. B. The gene sequence structures of GhIAA16 and AtIAA16. Boxes indicate exons and lines represent introns (intron not drawn
to scale).
SUO Jin-Feng et al.: Identification of an Endothelium-specific Gene GhIAA16 in Cotton (Gossypium hirsutum) 477
although limited data indicate that the first group genes are
likely to precede the activities of members of the s econd
group (Schneitz, 1999).
Genes expres s ed in end o thelium are no t well
documented. Arabidopsis BANYULS (BAN) gene, which
most likely encodes a leucoanthocyanidin reductase and
restricts its expression to the endothelium of immature seeds
at the pre-globular to early globular stages of embryo de-
velopment (Devic et a l., 1999). It repres ents a marker for
early differentiation and development of the seed coat. BAN
is p robably involved in a metabolic channeling between
the production o f anthocyan ins and pro-anthocyanidins
in the seed coat (Devic et al., 1999). Another Arabidopsis
gene, TT16, encodes the ARABIDOPSIS BSISTER (ABS)
MADS domain protein and is expressed mainly in the ovule
(Nesi et al., 2002). TT16/ABS is necessary for BAN expres-
sion and proanthocyanidin accumulation in the endothe-
lium of the seed coat, with the exception of the chalazal-
micropylar area. In addition, mutant phenotype and ectopic
expression analyses suggested that TT16/ABS is also in-
volved in the s pecification of endothelial cells. It appears
that these two endothelium-expressed genes are all involved
in flavonoids production of the seed coat as well (Nesi et
Fi g.4. DNA blot ting analysis of cott on genomic DNA of
GhIAA16. Genomic DNA (20 mg/lane) of leaves of Gossypium
hirsutum cv. XZ142 (WT) and G. hirsutum cv. XZ142w (fl) was
completely digested with BamHI, EcoRI and HindIII respectively
and transferred on nylon membrane. The blot was hybridized
with a gene-specific probe of GhIAA16. Molecular weight makers
are indicated in kb.
Fig.5. Northern blotting analysis of GhIAA16. Total RNA (20
mg/lane) from +3, 0,-3 dpa ovules and leaves was fractioned on a
denat uring 1.2% (W/V) agarose gel and transferred to nylon
membrane. The blot was hybridized with the full-length cDNA of
GhIAA16. Loading control of total RNA was shown.
Fig.6. In situ RNA hybridization analysis of GhIAA16. Upper,
a longitudinal section of 0 dpa ovule hybridized by an antisense
probe of GhIAA16; lower, a longitudinal section of 0 dpa ovule
hybridized by sense probe of GhIAA16. The blue color indicates
the hybridizing signal. e, endothelium; i, inner seed coat; n, nucellus;
o, outer seed coat.
genes for the initiation of the integuments and an increas-
ing number o f genes for their morphogenes is have been
identified (Schneitz et al., 1998). The first group comprises
HLL, ANT, BEL1, INO, ABERRANT TESTA SHAPE (ATS)
and UNICORN (UCN). They act as positive regu lators of
early integument development, with the possible exception
of UCN. Genes of the second group include STRUBBELIG
(SUB) and BLASIG (BAG), LEUNIG (LUG), TOUSLED,
SHORT INTEGUMENTS (SIN1), SUP, TSO1 and others.
However, the genetic network of these genes is no t clear
Acta Botanica Sinica 植物学报 Vol.46 No.4 2004478
al., 2002).
Aux/IAA genes are early auxin response genes that en-
code short-lived nuclear proteins (Abel et al., 1994). Tiwari
et al. (2001) found that most of the Arabidopsis Aux/IAA
proteins repressed t ranscrip tion on auxin-responsive re-
porter genes in protoplast transfection assays. Their work
suggested that Aux/IAA proteins function as active re-
pressors by dimerizing with auxin response factors bound
to auxin response elements and that early auxin response
genes are regulated by auxin-modulated stabilities of Aux/
IAA proteins.
Whether the orthologs of these genes play roles in cot-
ton integument development is not clear. The identifica-
tion of GhIAA16 as an endothelium-specific gene suggests
that auxin plays a role in cotton ovule development. In fact,
the initiation of co tton fiber development appears to be
triggered by hormones, auxins and gibberellins. Gialvalis
and Seagu ll (2001) have demonst rated that unfert ilized
ovules produced large numbers of fiber initials in the ab-
sence of any hormone treatment. But exogenous applica-
tion of either indole-3-acetic acid or gibberellic acid induced
significant increases in fiber production. But the molecular
mechanism of this in fluence is unknown. GhIAA16 may
provide a molecular bridge between hormone IAA and cot-
ton fiber formation. The expression pattern of AtIAA16 re-
mains unclear. Direct t ransformat ion of Arabidopsis with
GhIAA16 (sense or antisense) did not result any obvious
phenotypic changes (data not shown), suggesting a diver-
sified role of IAA16, also supported by their different ge-
nomic structures (Fig.3). Further genetic transformation of
cotton likely reveals a role of GhIAA16, if any, in cotton
ovule development.
Acknowledgements: We thank Dr. DU Xiong-Ming from
Cotton Research Institute of The Chinese Academy of Ag-
ricultural Sciences for providing cotton fl mutants.
References:
Abel S, Theologis A. 1996. Early genes and auxin act ion. Plant
Physiol, 111:9-17.
Abel S, Oeller P W, Theologis A. 1994. Early auxin induced genes
encode short-lived nuclear proteins. Proc Natl Acad Sci USA,
91:326–330.
Ainley W M , Walker J C, Nagao R T, Key J L. 1988. Sequence
and charact eriz ation of t wo auxin-regulat ed genes from
soybean. J Biol Chem, 263:10658-10666.
Arabidopsis Genome Initiat ive. 2000. Analysis of the genome
sequence of the flowering plant Arabidopsis thaliana. Nature,
408:796-815.
Bao F, Hu Y, Li J. 2002. Identification of auxin responsive genes
in Arabidopsis by cDNA array. Chin Sci Bull, 47:548-552.
Boesewinkel F D, Bouman F. 1995. The seed: structure and
funct ion. Kigel J , Galili G. Seed Develop ment and
Germination. Washington, D C: Library of Congress. 1–24.
Devic M, Guilleminot J, Debeaujon I, Bechtold N, Bensaude E,
Koornneef M, Pelletier G, Delseny M. 1999. The BANYULS
gene encodes a DFR-like protein and is a marker of early seed
coat development. Plant J, 19:387-398.
Du X M, Pan J J, Wang R H, Zhang T Z, Shi Y Z. 2001. Genetic
analysis of present and absence of lint and fuzz in cot ton.
Plant Breeding, 120:519-522.
Gasser C S, Broadhvest J, Hauser B A. 1998. Genetic analysis of
ovule development. Annu Rev Plant Phys iol Plant Mol Biol,
49:1-24
Gialvalis S, Seagull R W. 2001. Plant hormones alter fiber initia-
tion in unfertilized, cultured ovules of Gossypium hirsutum. J
Cotton Sci, 5:252-258.
Hagen G, Guilfoyle T. 2002. Auxin-responsive gene expression:
genes, promoters and regulatory Factors. Plant Mol Biol, 49:
373-385.
Lai Z, Ma W S, Han B, Liang L Z, Zhang Y S, Xue Y B. 2002. The
self-incompatibility (S) locus encodes a novel F-box gene with
a male gametophytic expression in Antirrihium. Plant Mol
Biol, 50:29-42.
Léon-Kloos terziel K M, Bunt G A, Zeevaart J A D, Koornneef
M. 1994. Arabidopsis mutants with a reduced seed dormancy.
Plant Physiol, 110:233-240.
Leyser O. 2001. Auxin signalling: the beginning, the middle and
the end. Curr Opin Plant Biol, 4:382-386
Liscum E. Reed J W. 2002. Genetics of Aux/IAA and ARF action
in plant growth and development. Plant Mol Biol, 49:387-
400.
Nesi N, Debeaujon I, Jond C, Stewart A J, Jenkins G I, Caboche
M, Lepiniec L. 2002. T he TRANSPARENT TESTA16 locus
encodes the ARABIDOPSIS BSISTER MADS domain pro-
tein and is required for proper development and pigmentation
of the seed coat. Plant Cell, 14:2463-2479.
Pat erson A H, Brubaker C L, Wendel J F. 1993. A rap id met hod
for extract ion of cott on (Gossypium spp.) genomic DNA
suit able for RFLP or PCR analys is . Plant Mol Biol Rep,
11:122-127.
Schneitz K, Balasubramanian S, Schieft haler U. 1998. Organo-
genesis in plants: the molecular and genetic control of ovule
development. Trends Plant Sci, 3:468-472.
Schneitz K. 1999. T he molecular and genet ic control of ovule
development. Curr Opin Plant Biol, 2:13-17.
Tiwari S B, Wang X J, Hagen G, Guilfoyle T J. 2001. AUX/IAA
proteins are active repressors, and their stability and activity
are modulated by auxin. Plant Cell, 13:2809-2822.
SUO Jin-Feng et al.: Identification of an Endothelium-specific Gene GhIAA16 in Cotton (Gossypium hirsutum) 479
Wong L M, Abel S, Shen N, Foata M, Mall Y, Theologis A. 1996.
Differential activation of the primary auxin response genes,
PS-IAA4/5 and PS-IAA6, during early plant development. Plant
J, 9:587-599.
(Managing editor: ZHAO Li-Hui)
Zhang T-Z, Pan J-J. 1991. Genetic analysis of a fuzzless-lintless
mutant in Gossipium hirsutum L. Jiangsu Agric Sci,7:13-16.
(in Chinese with English abstract)