全 文 ：Received 28 Mar. 2003 Accepted 30 Jun. 2003
Supported by the State Key Basic Research and Development Plan of China (2002CB111300).
* Author for correspondence. E-mail: .
http://www.chineseplantscience.com
Acta Botanica Sinica
植 物 学 报 2004, 46 (4): 463-471
Cloning and Characterization of the Coding Sequences of the 1Ay High
Molecular Weight Glutenin Subunit Genes from Triticum urartu
BAI Jian-Rong1, 2, JIA Xu1, LIU Kun-Fan1, WANG Dao-Wen1*
(1. State Key Laboratory of Plant Cell and Chromosome Engineering, Institute of Genetics and Developmental Biology,
The Chinese Academy of Sciences, Beijing 100101;
2. Crop Genetics Institute, Shanxi Academy of Agricultural Sciences, Taiyuan 030031, China)
Abstract: Using degenerate oligonucleotide primers and genomic PCR reactions, the complete coding
region sequences of two 1Ay high molecular weight (HMW) glutenin subunit genes were amplified from
Triticum urartu accessions that showed differential expression of the 1Ay HMW glutenin subunits in their
seeds. The coding sequence amplified from the accession that expressed the 1Ay gene (Tu1Ay-e) was
highly homologous to that of known y type HMW glutenin subunit genes. Consequently, the primary
structure of the protein translated from the coding sequence of Tu1Ay-e was ident ical to that of
previously published y type subunits. Bacterial expression of the coding sequence of Tu1Ay-e produced a
polypeptide identical to the 1Ay subunit extracted from seeds, indicating that the cloned sequence was an
accurate representation of the original coding region of Tu1Ay-e. In contrast, the coding region sequence
amplified from the accession that did not express 1Ay subunit contained three in-frame premature stop
codons. Based on past findings on silenced HMW glutenin subunit genes, we conclude that the presence of
in-frame premature stop codon(s) is an important feature of the silenced 1Ay gene (Tu1Ay-s) in T. urartu.
The potential value of the active 1Ay gene in improving the end use quality of common wheat and the
mechanism underlying 1Ay gene silencing are discussed.
Key words: high molecular weight glutenin subunit; 1Ay; Triticum urartu ; common wheat
As an important component of seed storage proteins,
high molecular weight glutenin subunits (HMW-GSs) ac-
count for 10% of the total seed proteins in common wheat
(Payne, 1987; Shewry et al., 1995; 2002). Their composition
and function can directly influence the end use quality of
wheat grains (Payne, 1987; Shewry et a l., 1995; 2002). In
common wheat (Triticum aestivum, AABBDD), genes en-
coding HMW-GSs are contained in three homoeologous
loci (Glu-A1, Glu-B1, Glu-D1) (Payne et al., 1983; Payne,
1987). Within each locus, there are two tightly linked genes
(x and y). The two genes encode a higher molecular mass x
type and a lower molecular mass y type subunits, respec-
tively (Payne et a l., 1983; Payne, 1987). Owing to allelic
variation and gene silencing, common wheat varieties usu-
ally express three to five HMW-GSs, and the composition
of HMW-GSs often differs among individual varieties (Payne
et al., 1983; Payne, 1987). The y gene in the Glu-A1 locus
(1Ay) is silenced in common wheat variet ies (Forde et a l.,
1985; Harberd et a l., 1987; Halford et a l., 1989). Several
reports have investigated the mechanisms underlying the
silencing of the 1Ay gene. Forde et al. (1985) showed that
the silencing of the 1Ay gene in variety Cheyenne was
associated with the presence of a p remature stop codon
with in its coding region . Harberd et a l. (1987) found the
insertion of a transposon-like element in the coding region
of the 1Ay gene in variety Chinese Spring. By studying the
promoter sequence of the 1Ay gene in variety Cheyenne,
Halford et al. (1989) later speculated that 1Ay gene silenc-
ing might be caused by specific nucleotide substitutions in
the promoter region immediately upstream of the transcrip-
tion start point.
In the wild tetraplo id wheat Tri ticum turgidum s sp .
dicoccoides (AABB), the 1Ay gene is silenced in some ac-
cessions but not in others (Ciaffi et al., 1993). But the mecha-
nism involved in 1Ay silencing in the tetraploid wheat has
not been inves tigated. The 1Ay gene is also differentially
silenced in the acces sions of the diplo id wheat species
Triticum urartu (AuAu) (D’Ovidio et al., 1996). D’Ovidio et
al. (1996) compared the promoter sequences from expressed
and silenced 1Ay genes of T. urartu. They concluded that
there were no significant nucleotide sequence differences
between the promoter regions immediately upstream of the
transcription start point between the expressed and silenced
1Ay genes. They further speculated that promoter defect
Acta Botanica Sinica 植物学报 Vol.46 No.4 2004464
might not be the cause for 1Ay silencing in common wheat
variety Cheyenne. However, to date, it is unknown if 1Ay
gene silencing in T. urartu is also associated with defect in
the coding region (as in the coding regions of the silenced
1Ay genes in common wheat varieties Cheyenne and Chi-
nese Spring). Neither do we have information on potential
differences between the coding regions of the expressed
and silenced 1Ay genes in any diploid wheat accessions.
Molecular comparison has revealed that the coding re-
gion sequences of HMW-GSs are high ly homologous
(Shewry et al., 1995; 2002). As a res ult, the primary struc-
tures of different HMW-GSs are very similar. The modular
organization of the primary structure of HMW-GS consists
of a s ignal peptide, the N terminal domain, the central re-
petitive domain, and the C terminal domain (Shewry et al.,
1995; 2002). While the size of the signal peptide and the N
and C terminal domains are well conserved among different
HMW-GSs, the leng th of the repetitive domain can vary
extensively (Shewry et al., 1995; 2002). The repetitive do-
main is composed of short repeated peptide motifs (Shewry
et al., 1995; 2002). Length differences among the repetitive
domains of different HMW-GSs are caused by changes in
the numbers of the short repeated peptide motifs (Shewry
et al., 1995; 2002). The conservation of the coding region
sequences among HMW-GS genes has facilitated the de-
sign of PCR primers that can be used to amplify the coding
regions of novel HMW-GSs from wheat and related spe-
cies (Xie et al., 2001; Liu et al., 2002; Wan et al., 2002; Liu et
al., 2003).
Previous studies have shown that T. urartu is likely to
be donor of the A genome in common wheat (Dvorak et al.,
1993; Feldman, 2000). This species posses ses many char-
acters that can potentially be employed to improve the ag-
ronomic traits of common wheat varieties (Damania, 1993).
Researchers have suggested that the expressed 1Ay gene
of T. urartu may be used to enhance the processing prop-
ert ies of common wheat if it can be trans ferred into the
hexaploid genomic background (Waines and Payne, 1987).
Gene transfer between wheat and related species has , in
the past, been achieved mainly through wide hybridization
and chromosome engineering (Lupton, 1987). But this pro-
cess is labor-intensive and time-consuming. Currently, gene
transfer within and between plant species is mostly accom-
plished through genetic transformation (Barsby et al., 2000),
but a prerequ isite of this pract ice is the iso lation of the
coding s equence of the gene that is to be transferred. To
obtain the coding sequence of the expressed 1Ay gene for
potential app lication in improving the end use quality o f
common wheat and to further s tudy the mechan is m
underlying 1Ay gene silencing, we conducted a series of
experiments aiming at isolating and characterizing the com-
plete coding sequences of the silenced and expressed 1Ay
genes in T. urartu. In the light of our result s and those
published previously, the potential value of the expressed
1Ay gene in improving the end use quality of common wheat
and the mechanism underly ing 1Ay gene silencing are
discussed.
1 Materials and Methods
1.1 Plant materials
Seven accessions of Trit icum urartu (IZ29-1, DV868,
DV867, DV877, DV865, G1958, G3159) were obtained from
the University of California, USA. Two access ions o f T.
boeot icum (As261, As 262) and one acces s ion o f T.
monococcum (As265) were provided by the Triticeae Re-
search Institute of Sichuan Agricultural University, China.
HMW glutenin subunits in the common wheat variety Chi-
nese Spring (1Bx7, 1By8, 1Dx2, 1Dy12) were used as con-
trols for SDS-PAGE analysis.
1.2 SDS-PAGE analysis
Preferential extraction of HMW glutenin subunits from seed
materials and SDS-PAGE analysis of the extracted subunits
were conducted as described previously (Wan et al., 2000).
1.3 Amplification and cloning of the complete coding
region sequences of 1Ay genes
Following a published protocol (Guidet et al., 1991), ge-
nomic DNA samples were p repared from T. urartu, T.
boeoticum and T. monococcum accessions. For amplifying
the complete coding sequence of the 1Ay gene by genomic
PCR reactions, a pair of degenerate oligonucleo tide prim-
ers (P1, P2) were syn thesized based on conserved nucle-
otide sequences at the 5 and 3 ends of the coding regions
of pub lis hed HMW glu ten in subunit genes . P1 (5-
ATGGCTAAGCGG C/TTA/GGTCCTCTTTG-3) contained
the start codon (underlined nucleotides). P2 (5-CTATCA
CTGGCTG/AGCCGACAATGCG-3) possessed the tandem
stop codons (underlined nucleotides). Each genomic PCR
reaction (100 mL volume) con tained 300 ng template, 0.2
mmol/L of each of the four dNTPs, 1 mmol/L of each of the
two primers, 10 mL PCR buffer, and 5 units of the high fidel-
ity polymerase Ex Taq (TaKaRa). The cycling parameters
for the PCR reaction were as described in a previous publi-
cation (Liu et al., 2002). PCR products were fractionated in
0.8% agarose gels. The desired DNA fragments were puri-
fied using a gel extraction kit, followed by cloning into the
plasmid vector pGEM-T Easy vector (Promega). After re-
st rict ion enzyme d iges tion analys is and partial DNA
sequencing, the insert in the plasmid clone p1Ay(Tu-e) was
BAI Jian-Rong et al.: Cloning and Characterization of the Coding Sequences of the 1Ay High Molecular Weight Glutenin
Subunit Genes from Triticum urartu 465
deduced to represent the complete coding region sequence
of the expressed 1Ay gene from T. urartu accession IZ29-1.
The insert in another plasmid clone p1Ay(Tu-s) represented
the complete coding region sequence of the silenced 1Ay
gene from T. urartu accession DV868.
1.4 Bacterium expression of the coding sequence of the
expressed 1Ay gene
For bacterium expression, the insert in p1Ay(Tu-e) was
modified by PCR mutagenesis using two oligonucleotide
p r i m e r s 1 A y F a n d 1 A y R . 1 A y F ( 5 -
ACCCATATGAAAGGTGAGGCCTCT AGG-3) and 1AyR
(5-CTAGAATTCCTATCACTGGCTGGCCGA-3) contained
the int roduced res t rict ion sites NdeⅠ and EcoRⅠ
(italicized nucleotides), respectively. This modification re-
moved the coding sequence of the signal peptide (to facili-
tate the expression of the mature 1Ay protein in bacterial
cells) and, meanwhile, introduced two restriction sites (for
cloning into expression vector). PCR amplification o f the
modified coding region was conducted as described above.
The resulted fragment was cleaved with NdeⅠ and EcoRⅠ,
followed by clon ing in to the bacterial express ion vector
pET-30a (Inv itrogen). The expression cons truct pET1Ay
(Tu-e) was introduced into the bacterial st rain BL21(DE3)
pLys S. Induction o f bacterial expres sion using IPTG
(is opropylthio-b-D-galactos ide, Sigma) and SDS-PAGE
analysis of bacterial protein extracts were carried as previ-
ously reported (Wan et al., 2002; Liu et a l., 2003). To pre-
pare bacterial protein extracts for SDS-PAGE analysis, the
protocol developed by Mackie et al. (1996) was adopted.
This protocol allowed preferential extraction of the HMW
glutenin subunit that was expressed in bacterial cells.
1.5 Western blotting analysis
To check if the coding sequence of the expressed 1Ay
gene could direct the synthesis of the 1Ay subunit in bac-
terial cells , pro tein extract, prepared from IPTG-induced
bacterial cells that harbored the expres sion const ruct
pET1Ay(Tu-e), was fractionated in SDS-PAGE. The sepa-
rated proteins were transferred onto nylon membrane and
probed with a HMW glutenin subunit -specific rabb it
polyclonal antibody. The Western blot protocol described
by Wan et a l. (2000) was followed. The results were re-
corded using a digital camera (Coolpix990, Nikon).
1.6 Sequencing the cloned 1Ay coding regions and amino
acid sequence comparison
Overlapping subclones were prepared for the inserts in
p1Ay(Tu-e) and p1Ay(Tu-s), respectively, using nes ted
deletion (Sambrook et al., 1989). Nucleotide sequence was
determined from both strands by a commercial company
(TaKaRa). The complete cod ing region sequences were
assembled from nucleotide sequences derived from indi-
vidual subclones using the software DNASTAR (DNAstar
Inc.). Conceptual translation of DNA sequences and amino
acid s equence comparis on were carried out using
bioinformatic tools (BLAST, ORF finder, ClustalW) in the
NCBI (www.ncbi.n lm.nih.gov) o r EBI (www.ebi.ac.uk/
clustalw/index.html) websites . For trans lating the coding
region sequences of the silenced 1Ay genes, the in-frame
premature stop codons were ignored. The resulted amino
acid sequences were hypothetical, but nevertheless useful
in analyzing the structure of the coding regions of the si-
lenced 1Ay genes.
2 Results
2.1 SDS-PAGE analysis of HMW glutenin subunits in
diploid wheat accessions
HMW glutenin subunits from seven accessions of T.
urartu, two accessions of T. boeoticum and one accession
of T. monococcum were separated in SDS-PAGE (Fig.1). In
T. urartu, four accessions (IZ29-1, DV877, G1958, G3159)
expres sed both 1Ax (marked by as teris ks ) and 1Ay
(indicated by arrows) subunits, three accessions (DV868,
DV867, DV865) expressed 1Ax but lacked the expression of
the 1Ay subunit. Compared to HMW glutenin subunits of
Chinese Spring (Fig.1, lane 1), in T. urartu, the electro-
phoretic mobility of the 1Ax subunit was generally close to
that of 1Dx2 (Fig.1), whereas the electrophoretic mobility of
the 1Ay subunit was much faster than the one s hown by
1Dy12 (Fig.1). The 1Ax and 1Ay s ubunits were both ex-
pressed in the two access ions o f T. boeoticum and one
accession of T. monococcum (Fig .1). The electrophoretic
mobilities of the 1Ax subunits from T. boeoticum and T.
monococcum were similar to those displayed by the 1Ax
subunits from T. urartu (Fig.1). In contrast, the 1Ay sub-
units from T. boeoticum and T. monococcum migrated con-
siderably slower than orthologous subunits from T. urartu
Fig.1. SDS-PAGE analysis of HMW-GSs in ten diploid wheat
accessions. Lanes 1 t o 11 cont ain seed prot ein samples from
Chinese Spring, IZ29-1, DV868, DV867, DV877, DV865, G1958,
G3159, As261, As262 and As265, respectively. Asterisks indi-
cate 1Ax subunits, whereas arrows mark 1Ay subunits. 2, 7, 8
and 12 on the left side of the graph represent 1Dx2, 1Bx7, 1By8
and 1Dy12 subunits of Chinese Spring, respectively.




Acta Botanica Sinica 植物学报 Vol.46 No.4 2004470
The nucleotide sequence of the complete coding region
of the silenced 1Ay gene from T. urartu accession DV868
was also highly homologous to that of known y type HMW-
GS genes. However, it could not be t ranslated into an in-
tact HMW-GS-like polypeptide owing to the presence of
three in-frame premature stop codons. At present, it is not
known if the p remature stop codons are directly respon-
s ib le for the silencing o f the 1Ay gene in T. urartu .
Theoretically, 1Ay gene silencing may also be due to po-
tential defects in gene transcription and/or mRNA stability.
Addit ional studies are therefore needed to investigate if
the silenced 1Ay gene is transcribed in the developing seeds
and the stability of its mRNA if it is transcribed.
From an evolutionary point of view, it is currently diffi-
cult to predict if the silencing of the 1Ay gene in tetraploid
and hexaploid (common) wheats can all be traced back to
the silencing of this gene in T. urartu. From the structural
features of the three silenced 1Ay genes studied so far, it
appears that the process(s) leading to 1Ay gene silencing
in diploid and hexap loid common wheats may share both
similarity and difference. The similarity is that the presence
of in -frame premature s top codon(s) in the sequence en-
coding the repetitive domain is associated with the silenc-
ing o f the 1Ay genes in both common wheat (variety
Cheyenne) and T. urartu (accession DV868). However, the
two silenced 1Ay genes differ in bo th the numbers and
pos itions o f the premature stop codons in their cod ing
regions. Another important finding is that the silencing of
the 1Ay gene in the common wheat variety Chinese Spring
is accompanied by the insertion of a transposon-like ele-
ment in its coding region (Harberd et al., 1987). It remains
unknown if this type of insertional event also exists in the
silencing of the 1Ay gene in an as yet unstudied T. urartu
accession. Clearly, further studies, involving more T. urartu
and T. turgidum ssp. dicoccoides accessions, are required
to establish the pattern of 1Ay gene silencing and the evo-
lutionary relationships between the silenced 1Ay genes in
diploid, tetraploid, and hexaploid wheats.
Acknowledgements: We thank Dr. WAN Yong-Fang for
help in analyzing the amino acid sequences of HMW glute-
nin subunits. The sequences reported in this paper have
been deposited in the EMBO database with accession num-
bers AY245578 (the active 1Ay gene) and AY245579 (the
silenced 1Ay gene).
References:
Ciaffi M, Lafiandra D, Porceddu E, Benedettelli S. 1993. Storage
protein variat ion in wild emmer wheat (Triticum turgidum
ssp. dicoccoides) from Jordan and Turkey. Ⅰ. Electrophoretic
characterization of genotypes. Theor Appl Genet, 86:474-
480.
Barsby T, Power J B, Freeman J, Ingram H M , Livesey N L,
Risacher T, Davey M R. 2000. Transformation of wheat.
Bonjean A P, Angus W J. The World Wheat Book: a History
of Wheat Breeding. New York: Intercept Ltd. 1081-1103.
Damania A B. 1993. Biodiversit y and Wheat Imp rovement.
Chichester, UK: John Wiley & Sons.
D’Ovidio R, Masci S, Porceddu E. 1996. Sequence analysis of the
5 non-coding regions of active and inactive 1Ay HMW glute-
nin genes from wild and cultivated wheats. Plant Sci, 114:61-
69.
Dvorak J, Di Terlizzi P, Zhang H B, Resta P. 1993. The evolution
of polyploid wheats: Identification of the A genome species.
Genome, 36:21-31.
Feldman M. Origin of cultivated wheat. Bonjean A P, Angus W J.
2000. The World Wheat Book: a History of Wheat Breeding.
New York: Intercept Ltd. 3-56.
Forde J, Malpica J M, Halford N G, Shewry P R, Anderson O D,
Greene F C, Miflin B J. 1985. The nucleotide sequence of a
HMW subunit gene located on chromosome 1A of wheat
(Triticum aestivum L.). Nucleic Acids Res, 13:6817-6832.
Guidet F, Rogowsky P, Christopher T , Song W, Langridge P.
1991. Cloning and characterization of a new rye-specific re-
peated sequence. Genome, 34:81-87.
Halford N G, Forde J, Shewry P R, Kreis M. 1989. Functional
analysis of the upstream regions of a silent and an expressed
member of a family of wheat seed protein genes in transgenic
tobacco. Plant Sci, 62:207-216.
Harberd N P, Flavell R B, Thompson R D. 1987. Identification of
a transposon like insertion in a Glu-1 allele of wheat. Mol Gen
Genet, 209:326-332.
Liu Z-J, Zhang X-M, Wan Y-F, Liu K-F, Wang D-W. 2002. Char-
acterization of high molecular weight glutenin subunit s and
their coding genes from Aegilops umbellulata. Acta Bot Sin ,
44:809-814.
Liu Z , Yan Z, Wan Y, Liu K, Zheng Y, Wang D. 2003. Analysis
of HMW glutenin subunits and their coding sequences in two
diploid Aegilops species. Theor Appl Genet, 106:1368-1378.
Lupton F G H. 1987. Wheat Breeding: Its Scientific Basis. New
York: Chapman and Hall. 1987.
Mackie A M, Lagudah E S, Sharp P J, Lafiandra D. 1996. Molecu-
lar and biochemical characterization of HMW glutenin sub-
units from T. tauschii and the D genome of hexaploid wheat. J
Cereal Sci, 23:213-225.
Payne P I, Lawrence G J. 1983. Catalogue of alleles for the com-
plex gene loci Glu-A1, Glu-B1 and Glu-D1, which code for the
high molecular weight subunits of glutenin in hexaploid wheat.
Cereal Res Commun, 11:29-35.
BAI Jian-Rong et al.: Cloning and Characterization of the Coding Sequences of the 1Ay High Molecular Weight Glutenin
Subunit Genes from Triticum urartu 471
Pay ne P I. 1987. Genetics of wheat s torage p roteins and the
effect of allelic variation on breadmaking qualit y. Ann Rev
Plant Physiol, 38:141-153.
Sambrook J, Fritsch E F, Maniatis T. 1989. Molecular Cloning: a
Laboratory Manual. 2nd ed. New York: Cold Spring Harbor
Laboratory Press.
Shewry P R, Tatham A S, Barro P, Lazzeri P. 1995. Biotechnol-
ogy of breadmaking: unraveling and manipulating the multi-
protein gluten complex. Bio/Technology, 13:1185-1190.
Shewry P R, Halford N G, Belton P S, Tatham A S. 2002. The
structure and properties of gluten: an elastic prot ein from
wheat grain. Phil Trans R Soc Lond B, 357:133-142.
Waines J G, Payne P I. 1987. Electrophoretic analysis of the high-
molecular-weight subunits of Triticum monococcum, T.
urar tu, and t he A genome of bread wheat. Theor Appl Genet,
74:71-76.
Wan Y, Liu K, Wang D, Shewry P R. 2000. High-molecular-
weight glutenin subunits in the Cylindropyrum and Vertebrata
section of the Aegilops genus and identification of subunits
related to those encoded by the Dx alleles of common wheat.
Theor Appl Genet, 101:879-884.
Wan Y, Wang D, Shewry P R, Halford N G. 2002. Isolation and
characterization of five novel high molecular weight subunit
genes from Triticum timopheevi and Aegilops cylindrica. Theor
Appl Genet, 104:828-839.
Xie R L, Wan Y F, Zhang Y, Wang D W. 2001. HMW glut enin
subunits in multiploid Aegilops species: composition analy-
sis and molecular cloning of coding sequences. Chin Sci Bull,
46:309-313.
(Managing editor: ZHAO Li-Hui)