全 文 ：Received 4 Feb. 2004 Accepted 25 May 2004
Supported by the National Natural Science Foundation of China (30125029), the Natural Science Foundation of Yunnan Province, China
(2002C0041M), Shanghai Commission of Science and Technology (03DJ14014) and the Hi-Tech Research and Development (863) Program
of China (AA211091).
* Author for correspondence. Tel (Fax): +86 (0)21 65643668; E-mail: .
http://www.chineseplantscience.com
Acta Botanica Sinica
植 物 学 报 2004, 46 (12): 1458-1467
Estimating Genetic Diversity of Rice Landraces from Yunnan by SSR Assay
and Its Implication for Conservation
ZHU Ming-Yu1, 2, WANG Yun-Yue2, ZHU You-Yong2, LU Bao-Rong1*
(1. Ministry of Education Key Laboratory for Biodiversity and Ecological Engineering, Institute of Biodiversity Science,
Fudan University, Shanghai 200433, China;
2. Ministry of Education Key Laboratory of Agriculture Biodiversity for Plant Disease Management, Key Laboratory of Plant
Pathology, Yunnan Agricultural University, Kunming 650201, China)
Abstract: Eighty-five rice (Oryza sativa L.) varieties, including 82 rice landraces collected from 17
villages in Yunnan Province of China and three standard varieties representing typical Indica and Japonica
ecotypes, were studied using simple sequence repeat (SSR) markers to estimate their genetic diversity for
the purpose of strategic conservation. Nineteen selected SSR primer pairs amplified a total of 83 SSR
alleles, with molecular weight ranging from 100 to 500 bp, from the 85 rice varieties. An UPGMA dendro-
gram based on the cluster analysis of genetic similarity of the SSR alleles showed a significant genetic
variation among the included rice varieties, with the similarity coefficients varying between 0.152 and
0.900. However, genetic diversity of the rice varieties collected from Yunnan was unevenly distributed
over their geographical locations. Two distinct groups were identified from the cluster analysis of the 85
rice varieties at the similarity coefficient level of 0.152, with one group that included almost all accessions
of Indica ecotype and another group that contained all accessions of Japonica ecotype. Varieties that
shared the same names but collected from different villages did not always show a close genetic relationship,
indicating misidentification of some varieties by local farmers. It is concluded from this study that conser-
vation of genetic diversity in rice landraces is urgently necessary in Yunnan, given their high level of
diversity, but an appropriate strategy needs to be followed to guarantee the effectiveness of conservation
activities. Properly selected SSR primer pairs might provide an ideal method for identifying Indica and
Japonica ecotypes for rice conservation and breeding programs.
Key words: Oryza sativa; rice landrace; differentiation; SSR; conservation; molecular marker
China is the world largest rice (Oryza sativa)-produc-
ing and -consuming country, where rice culture also plays
an important role in indigenous beliefs and practices in
many agricultural regions. As a part of the origin and di-
versification center for Asian cultivated rice — an area
that also includes Nepal, Bhutan, northeastern India
(Assam), Myanmar, Laos and northern Thailand (Chang,
1976; 1985; Wang and Sun, 1996; Zeng et al., 1998).
China has accumulated tremendously rich genetic diver-
sity in the rice gene pool through thousands of years of
cultivation and selection by local farmers in various agro-
ecosystems. As a result, a great number of rice landraces
have been widely cultivated in this country, particularly in
its southern parts. According to the statistics of the Insti-
tute of Crop Germplasm Resources, Chinese Academy
of Agricultural Sciences, more than 76 600 accessions
of rice germplasm were collected through nationwide
germplasm explorations during the last 50 years, and
among these, over 53 300 accessions were landraces
(Ying, 2000).
Yunnan is a mountainous province, in the southwest of
China, containing the country’s greatest level of plant and
animal species diversity. It is also the most diverse region
in China in terms of its geographical landscapes, climatic
conditions, agricultural ecosystems, biological diversity,
and endemic ethnic cultures. A remarkably diverse set of
rice landraces, including upland and lowland, glutinous and
non-glutinous, and Indica and Japonica varieties, was
found in Yunnan Province (Zhang et al., 2001). These rice
varieties have played a very important role in the local food
security and sustainable development of agriculture, in
addition to their significant values as genetic resources for
rice genetic improvement (Lu and Zhu, 1995; Li and Rutger,
2000; Tang, 2002).
However, with the increasing challenge of food security,
rice production in Yunnan, as in many other rice-growing
ZHU Ming-Yu et al.: Estimating Genetic Diversity of Rice Landraces from Yunnan by SSR Assay and Its Implication for
Conservation 1459
regions in China, followed a high input and output model
in the past decades to achieve its high yield. Undoubtedly,
the intensive agricultural practice of the cultivation of im-
proved high-yielding modern rice varieties on an extensive
acreage contributed remarkably to the increase in local food
production. However, it also resulted in significant “ge-
netic erosion”¾ the loss of traditional varieties from agro-
ecosystems (Porceddu et al., 1988; Singh, 1999) — in the
rice gene pool, in addition to the deterioration of the rice
ecological systems. The loss of genetic diversity has con-
siderably hindered our efforts for consistently high pro-
duction and further improvement of rice varieties adapting
to various biotic and abiotic stresses that can significantly
reduce productivity of rice varieties. All of these together
will threaten long-term food security in the region. Therefore,
strategic conservation of genetic resources in the rice gene
pool has become increasingly important for ensuring the
sustainable production of this food crop.
For the effective conservation of rice genetic resources,
a clear understanding of differentiation and relationships
of rice varieties from a targeted region is essential for deter-
mining the appropriate sampling and management
procedures. Traditional customs of rice cultivation and
management in relation to other crops, the frequency and
intensity of rice varietal exchanges among villages and
regions, and cultural practices that would influence the
availability of a certain type of rice varieties, all need to be
understood. One of the important parameters for effective
genetic conservation is to detect the allelic richness of the
population or samples that are targeted for conservation.
Molecular marker technology is one of the powerful tools
for determining genetic variation in rice varieties (Xu and
Wang, 1974; Zhang et al., 1992; Lu and Zhu, 1995; Zeng
and Zheng, 2001; Lu et al., 2002), in addition to the under-
standing of relationships between genetic diversity and
culture aspects of rice, which would facilitate the effective
conservation of genetic resources in the rice gene pool by
strategic decision-making.
Simple sequence repeats (SSR), also referred to as
microsatellites, are useful markers for studying genetic dif-
ferentiation and relationships, because of the significant
level of allelic polymorphisms that can be readily revealed
(Ishii et al., 2001). Polymorphisms in the microsatellite re-
gions are considered to be the result of mis-replication of
repeated sequences (Richards and Sutherland, 1994). The
resultant polymorphisms can be detected by PCR amplifi-
cation using pairs of primers specific to the sequences flank-
ing the microsatellite repeats. Microsatellite markers are
supposed to be particularly suitable for evaluating genetic
diversity and relationships among closely related plant
accessions or individuals, such as different rice cultivars
(Akagi et al., 1997; Guo and Zhao, 1998). To date, more
than 2 500 SSR primer pairs have been developed in rice
(McCouch et al., 2002), which provides a tremendous op-
portunity for gaining an insight into the genetic structure
of the rice genome.
The objective of this study was to determine the pattern
of genetic differentiation of rice landraces collected from
the selected sites, representing the medium-developed ag-
ricultural regions in Yunnan Province, where modern im-
proved and traditional rice varieties are grown
simultaneously. This knowledge would allow estimation of
the values of local rice conservation programs, particularly
for on-farm management practices.
1 Materials and Methods
1.1 Plant materials
A total of 85 rice (Oryza sativa L.) accessions were used
in this study for the SSR analysis, including Indica and
Japonica ecotypes, as well as glutinous and non-gluti-
nous varieties. Most of the varieties were local landraces
commonly cultivated in Yunnan Province. Of these, 74 ac-
cessions were collected directly from farmer households
scattered randomly in 16 villages belonging to two coun-
tries in 2002, and eight accessions were collected from an-
other village of Luxi County in the previous year (Table 1).
Three rice accessions, IR36, IR64 (from the Philippines),
and Nihonbare (originally from Japan) donated by the In-
ternational Rice GeneBank of the International Rice Re-
search Institute (IRRI) at Philippines, were used as the stan-
dard varieties representing the typical Indica and Japonica
ecotypes, respectively. Owing to the highly homogeneous
nature of rice varieties, particularly the traditional varieties,
one seed randomly selected from each accession was in-
cluded in the analysis to represent the variety.
1.2 DNA extraction and PCR assay
DNA samples were extracted from leaf tissues of a single
seedling at about the three-leaf stage, using the CTAB
method described by Song et al. (2003). A total number of
19 SSR primer pairs were selected to analyze genetic poly-
morphisms in the rice varieties (Table 2), based on the
RiceGenes Database (http://gramene.org/). Primer pairs were
chosen based on the number of alleles in each locus with
relatively high polymorphisms. The PCR reactions were
performed in a PTC 10096 V thermocycler (MJ Research
Inc., Watertown, Mass) programmed following the descrip-
tion by Wu and Tanksley (1993). A denaturation period of 4
min at 94 °C was followed by 36 cycles of 40 s at 94 °C, 30
Acta Botanica Sinica 植物学报 Vol.46 No.12 20041460
Table 1 Rice genetic resources used for the simple sequence repeat (SSR) analysis with information on their eco-types and origin in
Yunnan Province, except for the typical Indica IR36, IR64, and Japonica Niponbare. Landraces collected as the same variety names but
from different sites were identified by giving different numbers following the variety names
Variety Eco-type(1) Code Locality (Village/Town/County) Note(2)
Jinyougui-99 Indica JYG-99-I Yangjie/Xinshao/Mile
Yunhui-290 Indica YH-290-I Yangjie/Xinshao/Mile
Gangyou-225 Indica GY-225-I Yangjie/Xinshao/Mile
Teqing Indica TQ-I Yangjie/Xinshao/Mile
Diantuan-502-1 Indica DT-502-1-I Yangjie/Xinshao/Mile
Siyou Indica SY-I Donghong/Donghong/Mile
Diantuan-502-2 Indica DT-502-2-I Donghong/Donghong/Mile
Hongcheng Indica HC-I Donghong/Donghong/Mile
Hongyou Indica HY-I Donghong/Donghong/Mile
Guichao Japonica GC-I Donghong/Donghong/Mile
Huangkenuo-1 Japonica HKN-1-J Donghong/Donghong/Mile G
Hongzayou Indica HZY-I Donghong/Donghong/Mile
Jingdao-1 Japonica JD-1-J Donghong/Donghong/Mile
Xiandaonuo-1 Indica XDN-1-I Gucheng/Guishan/Xinping G
Xianggu Indica XG-I Gucheng/Guishan/Xinping
Yunuo-22 Indica YN-22-I Gucheng/Guishan/Xinping G
Jingdaoyunyou-4 Japonica JDYY-4-J Gucheng/Guishan/Xinping
Gangyou-22 Indica GY-22-I Gucheng/Guishan/Xinping
Eshandabagu Indica ESDBG-I Xiguan/Guishan/Xinping
Huangkenuo-2 Japonica HKN-2-J Xiguan/Guishan/Xinping G
Langanwuzui-1 Indica LGWZ-1-I Dabeimen/Guishan/Xinping
Xinyu-1 Indica XY-1-I Dabeimen/Guishan/Xinping
Langanwuzui-2 Indica LGWZ-2-I Gepeng/Gepeng/Xinping
Jindao-1 Japonica JD-1-J Gepeng/Gepeng/Xinping
Nuogu-1 Indica NG-1-I Gepeng/Gepeng/Xinping
Ganyou-12 Indica GY-12-I Gepeng/Gepeng/Xinping
Xiandaonuo-2 Indica XDN-2-I Gepeng/Gepeng/Xinping G
Hongta-4 Indica HT-4-I Gepeng/Gepeng/Xinping
Taibai-8 Japonica TB-8-J Gepeng/Gepeng/Xinping
Aixianlaopinzhong Indica AXLPZ-I Gepeng/Gepeng/Xinping
Nuogu-2 Indica NG-2-I Tala/Gucheng/Xinping
Aijiaonuo Japonica AJN-J Mangan/Pingzhang/Xinping G
Bingmangu Indica BMG-I Mangan/Pingzhang/Xinping
Guangtougu Japonica GTG-J Mangan/Pingzhang/Xinping
Heizinuo Indica HZN-I Mangan/Pingzhang/Xinping G
Hongxinnuo Indica HXN-I Mangan/Pingzhang/Xinping G
Mojiangnuo Indica MJN-I Mangan/Pingzhang/Xinping G
Qidaigu Indica QDG-I Mangan/Pingzhang/Xinping
Ruandao Indica RD-I Mangan/Pingzhang/Xinping
Shanyounuo Indica SYN-I Mangan/Pingzhang/Xinping G
Xiaohuanuo Indica XHN-I Mangan/Pingzhang/Xinping G
Yidalinuo Indica YDLN-I Mangan/Pingzhang/Xinping G
Yuanjiangnuo Indica YJN-I Mangan/Pingzhang/Xinping G
Daxiangnuo Indica DXN-I Fuku/Pingzhang/Xinping G
Shuijia-99 Indica SJ-99-I Fuku/Pingzhang/Xinping
Beizinuo Japonica BZN-J Cangfang/Pingzhang/Xinping G
Cuoluonuo Japonica CLN-J Cangfang/Pingzhang/Xinping G
Dabaigu Indica DBG-I Cangfang/Pingzhang/Xinping
Laoluochuan Indica LLC-I Cangfang/Pingzhang/Xinping
Lengshuiluochuan Indica LSLC-I Cangfang/Pingzhang/Xinping
Maidao Indica MD-I Cangfang/Pingzhang/Xinping
Bailengshui Japonica BLS-J Shanglongtan/Pingzhang/Xinping
Heilengshui Japonica HLS-J Shanglongtan/Pingzhang/Xinping
ZHU Ming-Yu et al.: Estimating Genetic Diversity of Rice Landraces from Yunnan by SSR Assay and Its Implication for
Conservation 1461
s at 55 °C, and 40 s at 72 °C, and then 10 min at 72 °C for
the final extension. Reactions were carried out in a vol-
ume of 20 mL containing 1× buffer, 1 mmol/L each of
dATP, dCTP, dGTP and dTTP, 10 mmol/L of SSR primer,
50 ng of genomic DNA and 0.6 unit of Taq polymerase
(TaKaRa Inc.).
The PCR products were separated in 6% polyacryla-
mide denaturing gels of 200×125×1 mm (length×width
×thickness) in size. Before sample loading, the PCR prod-
ucts were mixed with an equal amount of buffer and dena-
tured at 95 °C for 5 min. After electrophoresis, bands were
revealed using a modified silver staining procedure. The
gel was removed from the glass plates after electrophoresis
and fixed with 10% ethanol containing 0.5% acetic acid
solution. The fixed gel was washed twice with ddH2O, then
placed into a 200-400 mL solution of 0.1% AgNO3 solution
to stain for 10-18 min. The stained gel was transferred into
ddH2O and washed twice, then, placed in a 1.5% NaOH
solution (about 200-400 mL) containing 0.4% formaldehyde
and 0.019% sodium borate to develop for about 10 min
to obtain visible DNA bands. The developed gel was
washed with ddH2O twice and placed in 0.75% NaHCO3
to stop developing. The gel was covered with cellophane
to dry and photographs were taken using a digital camera
(Sony Inc.).
1.3 Genotype score and data analysis
The amplified SSR DNA bands representing different
alleles were scored as different genotypes. Banding pat-
terns identified in the rice varieties IR36, IR64, and Nihonbare
available at the RiceGenes Database were used as refer-
ence materials to help score different alleles in all the rice
samples. As a result, the co-dominant SSR banding pat-
terns were scored as AA, BB or CC (for homozygote) and
AB or BC (for heterozygote) genotypes corresponding to
Xiaoaijiao Japonica XAJ-J Shanglongtan/Pingzhang/Xinping
Cugeng-12 Japonica CG-12-J Lianhe/Pingzhang/Xinping
Huangkenuo-3 Japonica HKN-3-J Lianhe/Pingzhang/Xinping G
Tugu Japonica TG-J Lianhe/Pingzhang/Xinping
Xiluochuan Indica XLC-I Lianhe/Pingzhang/Xinping
Xinhuagu Indica XHG-I Lianhe/Pingzhang/Xinping
Yunuo Japonica YN-J Lianhe/Pingzhang/Xinping G
343 Japonica 343-J Lianhe/Pingzhang/Xinping
Aijiaohonggu (red) Indica AJHGR-I Shuoshan/Pingzhang/Xinping
Aijiaohonggu (white) Indica AJHGW-I Shuoshan/Pingzhang/Xinping
Bajiaxiang Indica BJX-I Shuoshan/Pingzhang/Xinping
Hexi-39 Japonica HX-39-J Shuoshan/Pingzhang/Xinping
Nanhua-2 Japonica NH-2-J Shuoshan/Pingzhang/Xinping
Shuangbaigu Japonica SBG-J Shuoshan/Pingzhang/Xinping
Chengjianghonggu Indica CJHG-I Baizhi/Pingzhang/Xinping
Maxiangu Indica MXG-I Baizhi/Pingzhang/Xinping
Xiandaohonggu Indica XDHG-I Baizhi/Pingzhang/Xinping
Beizigu Japonica BZG-J Kudumu/Pingzhang/Xinping
Yunyu-1 Japonica YY-J-1 Kudumu/Pingzhang/Xinping
Yuxinuo Japonica YXN-J Laotianzhai/Pingzhang/Xinping G
Heipinuo Indica HPN-I Yakou/Pingzhang/Xinping G
Hexi-41 Japonica HX-41-J Wujiepu/Luxi
Yanzhinuo Japonica YZN-J Wujiepu/Luxi G
Chugengxiang-1 Japonica CGX-1-J Wujiepu/Luxi
Niannuo-1 Japonica NN-1-J Wujiepu/Luxi G
Alunuo Japonica ALN-J Wujiepu/Luxi G
Milexianggu Japonica MLXG-J Wujiepu/Luxi
Chugeng-23 Japonica CG-23-J Wujiepu/Luxi
Hexi-39-2 Japonica HX-39-2-J Wujiepu/Luxi
IR36 Indica IR36-I Philippines
IR64 Indica IR64-I Philippines
Niponbare Japonica NIP-J Japan
(1), the Indica and Japonica eco-types were determined by farmers who provided the rice seeds and scientists from Yunnan Agricultural
University; (2), the symbol G indicates the glutinous rice.
Table 1 (continued)
Acta Botanica Sinica 植物学报 Vol.46 No.12 20041462
the alleles identified in the RiceGenes Database. The ra-
tios of shared DNA bands and similarity coefficients be-
tween accessions were quantified according to Nei
(1978). Relationships of the rice varieties were estimated
based on the similarity coefficient using the UPGMA clus-
tering method. The UPGMA tree was constructed using
the NTsyspc program ver. 20.2a (Rohlf, 1994).
2 Results
All of the 19 selected rice SSR primer pairs amplified
visible DNA bands from the included rice varieties and no
null alleles were detected. Most of the varieties had a unique
genotype. A total of 83 SSR alleles, with molecular
weights ranging from 100 to 500 bp, were scored from
the 85 rice varieties (Fig.1; Table 2). The highest number
(7) of alleles was scored from the locus RM21 and the
lowest (3 alleles) was found from the loci RM55, RM211,
RM212, RM215, and RM253 in the 85 rice samples (Table
2). The selected SSR primer pairs generated an average
of 4.37 alleles per locus and no monomorphic locus was
observed in the included rice samples.
A UPGMA dendrogram based on the cluster analysis
of Nei’s (1978) unbiased genetic similarity of the SSR
alleles was constructed for all the rice varieties. The clus-
Table 2 The SSR primer pairs used for genetic diversity study of 84 rice varieties
Locus LOC(1) Primer sequence(2)(5→ 3) Annealing temperature (°C) No. of alleles detected
RM11 7 F: tctcctcttcccccgatc 55 5
R: atagcgggcgaggcttag
RM14 1 F: ccgaggagaggagttcgac 55 5
R: gtgccaatttcctcgaaaaa
RM17 12 F: tgccctgttattttcttctctc 55 4
R: ggtgatcctttcccatttca
RM21 11 F: acagtattccgtaggcacgg 55 7
R: gctccatgagggtggtagag
RM55 3 F: ccgtcgccgtagtagagaag 55 3
R: tcccggttattttaaggcg
RM84 1 F: taagggtccatccacaagatg 55 4
R: ttgcaaatgcagctagagtac
RM167 11 F: gatccagcgtgaggaacacgt 4
R: agtccgaccacaaggtgcgttgtc
RM180 7 F: ctacatcggcttaggtgtagcaacacg 55 5
R: acttgctctacttgtggtgagggactg
RM211 2 F: ccgatctcatcaaccaactg 55 3
R: cttcacgaggatctcaaagg
RM212 1 F: ccactttcagctactaccag 55 3
R: cacccatttgtctctcattatg
RM215 9 F: caaaatggagcagcaagagc 55 3
R: tgagcacctccttctctgtag
RM219 9 F: cgtcggatgatgtaaagcct 55 4
R: catatcggcattcgcctg
RM222 10 F: cttaaatgggccatatgcg 55 5
R: caaagcttccggccaaaag
RM228 10 F: ctggccattagtccttgg 55 5
R: gcttgcggctctgcttac
RM230 8 F: gccagaccgtggatgttc 55 4
R: caccgcagtcacttttcaag
RM253 6 F: tccttcaagagtgcaaaacc 3
R: gcattgtcatgtcgaagcc
RM276 6 F: ctcaacgttgacacctcgtg 55 5
R: tcctccatcgagcagtatca
RM280 4 F: acacgatccactttgcgc 55 6
R: tgtgtcttgagcagccagg
RM289 5 F: ttccatggcacacaagcc 55 5
R: ctgtgcacgaacttccaaag
(1), location on the chromosome number; (2), F, forward primer; R, reverse primer.
ZHU Ming-Yu et al.: Estimating Genetic Diversity of Rice Landraces from Yunnan by SSR Assay and Its Implication for
Conservation 1463
ter analysis showed a significant genetic variation among
the included rice varieties with similarity coefficients
varying between 0.152 and 0.900 (Fig.2). The dendrogram
revealed two distinct groups at the similarity coeffi-
cient level of 0.152. Interestingly, the two groups of the
85 rice varieties were clearly associated with their
ecotypes, in other words, all the accessions of Indica
ecotype, including the standard varieties IR34 and IR 64,
were included in one group (upper cluster in Fig.2),
whereas the accessions of Japonica ecotype, including
the Nihonbare, were included in another group (lower clus-
ter in Fig.2). There was only one exception that an Indica
accession (HC-I) was included in the Japonica group. A
slightly greater genetic variation was observed among the
Indica varieties than among the Japonica varieties by a
brief comparison. The glutinous rice varieties were ran-
domly scattered among the Indica and Japonica varieties
without a particular differentiation pattern, indicating their
independent origin. Genetic differentiation of the rice
accessions seemed to have a weak association with their
village of origin. Only some rice accessions collected
from the same villages showed a relatively close genetic
relationship. In general, a relatively high level of genetic
diversity was detected in rice landraces from Pingzhang
Township of Xinping County, because these landraces
were scattered among different groups and subgroups in
the dendrogram.
It is noteworthy that the accessions labeled with the
same names but collected from different villages, so
Huangkenuo (HKN-1, HKN-2, and HKN-3), Nuogu (NG-1
and NG-2), and Langanwuzui (NGWZ-1 and LGWZ-2) did
not show identical genetic variation pattern, indicating a
considerable differentiation among the accessions identi-
fied as the same varieties. The two accessions of
Aijiaohonggu with different panicle colors, and identified
as AJHGW (white) and AJHGR (red), also demonstrated
a considerable genetic variation (Fig.2), suggesting the
discrepancy of genetic identity and varietal names of some
rice varieties.
3 Discussion
The effective and strategic conservation of genetic di-
versity in the rice gene pool relies essentially on the under-
standing of genetic diversity patterns of rice varieties in a
target region, including their levels and distribution of the
diversity (Zeng et al., 1998; Zhang, 2001; Lu et al., 2002).
This is particularly important for in situ conservation of
rice genetic diversity on farm management (or on-farm
conservation), because the combination of farmers’ diverse
needs together with the cultivation of varieties in different
ecosystems has created and accumulated wide genetic
variation. The continued cultivation and management of
different rice varieties by farmers would promote the con-
tinued availability of rice biodiversity in various rice eco-
systems (Zhu et al., 2003).
Results from this study evidently indicated that genetic
variation of rice varieties in the target region of Yunnan
Province is still remarkably rich, particularly among the tra-
ditional varieties, although only a relatively small set of rice
varieties was screened from three counties of a randomly
selected region in this analysis. This is the direct evidence
of maintaining rice diversity through farmer’s cultivation
and management. The considerably rich genetic diversity
of rice varieties in Yunnan Province could be attributed to
its complicated local geographical conditions where differ-
ent farming practices and ago-ecosystems exist. The diver-
sity may also be significantly associated with its rich eth-
nic and culture diversity that promotes miscellaneous needs
and applications of rice varieties. It is therefore very impor-
tant to have more thorough studies of farmer’s rice culture
at specific locations and its roles in maintaining genetic
diversity of rice varieties, which provides us a road-map for
strategic conservation of rice genetic resources. In addition,
local people have diverse dietary habits for rice products,
such as different types of rice noodles, rice cakes, rice wines,
and rice bread, which maintains the diversification of rice
varieties (Zeng et al., 1998; Zhang et al., 2001). More fol-
low-up investigations of such aspects in the target areas
need to be conducted. Relative isolation of these areas has
probably played a considerable role in reducing the speed
Fig.1. SSR amplification products generated by the primer pair
RM84. Lanes 1-21 represent XY-1-I, HX-39-J, YJN-I, HX-41-
J, SY-I, GC-I, XDN-1-I, NG-2-I, HC-I, JD-2-J, HKN-3-J, BZG-
J, HY-I, DBG-I, YDLN-I, JDYY-4-J, XG-I, XHN-I, ALN-J,
MLXG-J, IR36, IR64, and NIP. M, pUC19DNA/MspⅠ(HpaⅡ)
markers. Codes of the rice varieties refer to those in Table 1.
Acta Botanica Sinica 植物学报 Vol.46 No.12 20041464
Fig.2. A dendrogram showing relationships of Yunnan rice varieties based on the cluster analysis of Nei’s (1978) unbiased genetic
identity of 83 SSR alleles. A significant genetic variation and the clear grouping between Indica-Japonica ecotypes are indicated. Codes
of the rice varieties refer to those in Table 1.
ZHU Ming-Yu et al.: Estimating Genetic Diversity of Rice Landraces from Yunnan by SSR Assay and Its Implication for
Conservation 1465
of popularization and exchange of modern improved rice
varieties. Which of the factors have played an essential
role in maintaining the genetic diversity of Yunnan rice
varieties? More detailed studies of different sorts would
be accessory to determine these. This study that revealed
a significant level of genetic diversity has clearly demon-
strated the importance of continued in situ conservation
of traditional rice varieties suitable for various purposes
in different regions of Yunnan.
Data revealed by the cluster analysis of genetic similar-
ity of the 85 rice varieties based on the SSR variation pat-
tern provided particularly useful information for the effec-
tive conservation of rice genetic diversity in the target region.
Since the 19 SSR primer pairs can amplify DNA fragments
representing each chromosome, the diversity pattern re-
vealed by these SSR loci is meaningful. It is evident that
genetic diversity of the rice varieties is not evenly distrib-
uted in the sampled region, which indicated different ge-
netic relationships of these rice varieties. This suggests
that an appropriate sampling strategy based on the genetic
variation pattern should be followed to guarantee the maxi-
mum capture of rice genetic diversity in the given regions.
Therefore, the selection of traditional rice varieties for con-
servation should not be performed on a random basis;
instead, they should be selected according to the variation
pattern indicated by genetic studies. In other words, a quick
pre-screen of genetic differentiation and relationships of
rice varieties based on a small sample size (e.g. one seed
representing a variety) should be conducted before the
actual collection of these varieties for ex situ conservation.
This will provide a sound basis for a possible capturing of
maximum genetic diversity in the target regions. For example,
it was shown that some areas like Pingzhang township in
Xinping County possessed a slightly higher level of diver-
sity than the other areas based on the SSR analysis, a com-
paratively large number of varieties should be included from
such areas for conservation.
It should also be pointed out that traditional rice variet-
ies given the same name by local farmers might not neces-
sarily be the same varieties or the same genotypes. Results
from this study indicated that some varieties labeled with
the same varietal names by farmers in different villages or
counties, in fact, represented significantly different
genotypes. For instance, the varieties named by farmers as
Huangkenuo, Nuogu, and Langanwuzui collected from dif-
ferent villages actually demonstrated rather distant genetic
relationships. The variety AJHG with white and red panicles
also showed considerable differentiation. The genetic rela-
tionships of such varieties should be closely investigated.
Therefore, during the sampling process, if we exclude
those varieties labeled with the same names from differ-
ent localities, we may lose a considerable amount of ge-
netic diversity. On the contrary, some varieties with dif-
ferent varietal names, such as YN-22-I versus ESDBG-I
and MJN-I versus XHN-I showed a very close genetic
relationship. Their varietal status needs to be confirmed
by tracing their sources and origin. At least in the sam-
pling process, varieties sharing such a close genetic rela-
tionship should not all be included for conservation.
Furthermore, this study also demonstrated the useful-
ness of SSRs as molecular markers in determining genetic
diversity of rice landraces collected from Yunnan. It is im-
portant to point out that the SSR markers involved in this
study can distinguish the Indica and Japonica varieties
unambiguously. It is usually difficult to accurately identify
the Indica and Japonica ecotypes of rice by their morpho-
logical characteristics, and sometimes even by their isozyme
variation patterns (Li and Rutger, 2000; Tang, 2002). The
correct determination of the two ecotypes has a significant
value in rice breeding programs for selecting the desired
rice germplasm. Therefore, the great potential of employ
SSR analysis for accurate identifying the Indica and
Japonica ecotypes should be thoroughly explored by in-
clusion of a set of appropriately selected SSR primer pairs,
in addition to a wider range of well defined Indica and
Japonica rice germplasm for confirmation.
Acknowledgements: The first author would like to ex-
press his sincere appreciation to Dr. SONG Zhi-Ping of
Fudan University for his assistance in the SSR experiment
and to Mr. PENG Lei of Yunnan Agricultural University for
his help in collecting rice germplasm in Yunnan.
References:
Akagi H, Yokozeki Y, Inagaki A, Fujimura T. 1997. Highly poly-
morphic microsatellites of rice consist of AT repeats, and a
classification of closely related cultivars with these
microsatellite loci. Theor Appl Genet, 94: 61-67.
Chang T T. 1976. The origin and evolution, cultivation, dissemi-
nation and diversification of Asian and African rices. Euphytica,
25: 425-441.
Chang T T. 1985. Crop history and genetic conservation: rice —
a case study. Iowa State J Res, 59: 425-455.
Guo X-P, Zhao Y-M . 1998. SSR technique and its application in
plant genetics and breeding. Acta Agr Boreali-Sin , 13: 73-
76. (in Chinese with English abstract)
Ishii T, Xu Y, McCouch S R. 2001. Nuclear-and chloroplast-
Acta Botanica Sinica 植物学报 Vol.46 No.12 20041466
microsatellite variation in A-genome species of rice. Genome,
44: 658-666.
Litt M, Luty J A, 1989. Hypervariable microsatellite revealed by in
vitro amplification of a dinucleotide repeat within the cardiac
muscle action gene. Am J Human Genet, 44: 391-401.
Lu C-F , Zhu L-H. 1995. Molecular marker assisted selection in
plant breeding. Prog Biotech , 15: 11-17. (in Chinese with
English abstract)
Lu B R, Zheng K L, Qian H R, Zhuang J Y. 2002. Genetic
differentiation of wild relatives of rice as referred by the RFLP
analysis. Theor Appl Genet, 106: 101-106.
Martin C, Juliano A, Newbury H J, Lu B R, Jackson M T, Ford-
Lloid B V. 1997. The use of RAPD markers to facilitate the
identification of Oryza species within a germplasm collection.
Genet Resour Crop Evol, 44: 175-183.
McCouch S R, Teytelman L, Xu Y B, Lobos K B, Clare K,
Walton M, Fu B, Maghirang R, Li Z K, Xing Y Z, Zhang Q F,
Kono I, Yano M, Fjellstrom R, DeClerck G, Schneider D,
Cartinhour S, Ware D, Stein L, 2002. Development and map-
ping of 2 240 new SSR markers for rice (Oryza sativa L.).
DNA Res, 9: 199-207.
Nei M. 1978. Estimation of average heterozygosity and genetic
distance from a small number of individuals. Genetics, 89:
583-590.
Rohlf F J. 1994. NTSYS-pc, numerical taxonomy and multivari-
ate analysis system. ver. 1.80. Exeter Software, New York.
Porceddu E, Ceoloni C, Lafiandra D, Tanzarella O, Scarascia A,
Mugnoza G T. 1988. Genetic resources and plant breeding:
problems and prospects. Miller T E, Koebner R M D. Pro-
ceedings of the 7th International Wheat Genetics Symposium.
Cambridge, UK: Institute of Plant Science Research Press. 7-
21.
Richards R, Sutherland G R. 1994. Simple repeat DNA is not
replicated simply. Nat Genet, 6: 114-116.
Singh R K. 1999. Genetic resource and the role of international
collaboration in rice breeding. Genome, 42: 635-641.
Song Z P, Xu X, Wang B, Chen J K, Lu B R. 2003. Genetic
diversity in the northernmost Oryza rufipogon populations
estimated by SSR markers. Theor Appl Genet, 107: 1492-
1499.
Tang S-X, Jiang Y-Z, Wei X-H, Li Z-C, Yu H-Y. 2002. Genetic
diversity of isozymes of cultivated rice in China. Acta Agron
Sin, 28: 203-207. (in Chinese with English abstract)
Wang X-K, Sun C-Q. 1996. Origin and Differentiation of Chinese
Cultivated Rice. Beijing: China Agricultural University Press.
(in Chinese)
Xu X-H, Wang G-C, Zheng X-B, Wang H-X. 1974. A report on the
vertical distribution of the rice varieties in Simao, Yunnan. Acta
Bot Sin, 16: 208-222. (in Chinese with English abstract)
Ying C-S . 2000. Conservation and utilization of rice genetic re-
sources in China. Chin Rice Res Newsl, 8: 13-14. (in Chinese
with English abstract)
Zeng L-J , Zheng C-M . 2001. SSR technique and its application.
Chin J Trop Agr , 91: 56-59. (in Chinese)
Zeng Y, Wang J, Li X. 1998. Genetic variation of crop resources in
Yunnan Province, China. Plant Genet Resour Newsl, 114: 40-
42.
Zhang H, Shen S, Wang X, Zeng Y, Li Z, Yang Z. 2001. Ecological
and genetic diversity of rice germplasm in Yunnan, China.
PGR Newsl, 125: 24-28.
Zhu Y Y, Wang Y Y, Chen H R, Lu B R. 2003. Conserving tradi-
tional rice through biodiversity management. BioScience, 53:
158-162.
(Managing editor: ZHAO Li-Hui)