全 文 ：Received 20 Oct. 2003 Accepted 20 Dec. 2003
Supported by the Hi-Tech Research and Development (863) Program of China (001AA241032) and the National Natural Science
Foundation of China (30070397, 30370857).
* Author for correspondence. E-mail: .
http://www.chineseplantscience.com
Acta Botanica Sinica
植 物 学 报 2004, 46 (9): 1114-1121
DNA Transfer from Wild Millet to Common Wheat by
Asymmetric Somatic Hybridization
CHENG Ai-Xia, XIA Guang-Min*, CHEN Hui-Min
(School of Life Sciences, Shandong University, Jinan 250100, China)
Abstract: Following differing periods of long-term subculture and selection, two types of calli of the
same wheat (Triticum aestivum L. cv. Jinan 177) were obtained. The one (named Cha 9) grew fast and
easily formed cell suspensions that were non-regenerable, but the protoplasts possessed a high division
capacity. The other (named 176) was regenerable, but the derived protoplasts grew slowly. Fusion
combination between either Cha 9 or 176 protoplasts and UV-treated wild millet (Setaria italica L. Beaur.)
protoplasts failed to produce regenerated green plants. However, when the two types of wheat protoplasts
were mixed together as recipient and fused with wild millet, green plants were obtained. The hybrid nature
of regener-ated calli and plants was confirmed by the analysis of cytological, isozyme, 5S rDNA spacer
sequences and random amplified polymorphic DNA (RAPD). The chloroplast genomes of hybrids were
analyzed with several wheat-specific chloroplast microsatellite (simple sequence repeat, SSR) primers. A
hybrid clone carrying recipient DNA of Cha 9 and 176, as well as both nuclear and chloroplast donor DNA
had a high regeneration capacity and produced more vigorous green plants than did the other clones.
Key words: common wheat; wild millet; asymmetric somatic hybrid; SSR
A key goal of plant breeding is the construction of new
genotypes by the introduction and the manipulation of
genetic variation. Somatic hybridization via protoplast fu-
sion provides a route to combine genetic materials which
are not readily combinable via sexual means. Protoplast
fusion can also sometimes lead to the production of novel
genetic combinations, as a consequence of recombination
within either the nuclear and/or the cytoplasmic genomes.
Many interspecific, intergeneric, intertribal even interfamilial
somatic hybrid plants have been reported (Kisaka et al.,
1997). However, for common wheat, somatic hybridization
is relatively difficult, especially with phylogenetically dis-
tant species. Thus only albino plants could be regener-
ated from wheat (+) Setaria italica cv. Shanxi (Li et al.,
2001), wheat (+) Bromus inermis (Xiang et al., 1999) and
wheat (+) Avena sativa (Xiang et al., 2003). Recently,
however, we have been able to obtain green regenerants
from two asymmetric fusion combinations (wheat (+) A.
sativa (Xiang et al., 2002) and wheat (+) maize (Xu et al.,
2003)), by using two types of protoplast of the same wheat
(Triticum aestivum cv. Jinan 177) as the recipient “parent”.
In the present article, we report a further wide protoplast
fusion between the same recipient, and a wild species of
millet (Setaria italica Beaur.) as donor. This species is
characterized by levels of biotic and abiotic tolerance that
are not found in wheat. Our overall goal is to transfer rel-
evant nuclear and plastid genes to cultivated common
wheat to widen its genetic base. In addition, we are inter-
ested in exploring whether green hybrid plants can be re-
generated from this combination, and in confirming the
usefulness of the mixed wheat protoplasts for obtaining
successful remote somatic hybridization in wheat.
1 Materials and Methods
1.1 Protoplasts isolation and fusion
Methods for the induction, subculture and selection of
embryo-derived calli (176) and suspension cultures (Cha
9) of common wheat Triticum aestivum L. cv. Jinan 177
have been described elsewhere (Li et al., 1992). The 176
calli were subcultured on MB2 media for three years with
regeneration ability; and the Cha 9 suspension was sub-
cultured on MB2 liquid media for eight years, which could
not regenerate but grew vigorously. Embryogenic calli of
wild millet were induced from young embryos on MB me-
dium containing 2 mg/L 2,4-D at 25 ℃. After one year of
subculture and selection, yellow granular calli were ob-
tained and later subcultured on MB medium containing 1
mg/L 2,4-D. Subsequently, small granular calli were selected
for suspension in liquid MB medium containing 1 mg/L 2,
4-D.
CHENG Ai-Xia et al.: DNA Transfer from Wild Millet to Common Wheat by Asymmetric Somatic Hybridization 1115
Prior to incubation in enzyme solution (comprising 0.6
mol/L mannitol, 5 mmol/L CaCl2, 1.5% cellulase Onozyka
RS and 0.3% pectolyase Y-23, pH 5.8), fresh calli of 176
subcultured for 6-8 d, were chopped into pieces under
sterile conditions. Suspension cultures of Cha 9 and wild
millet sub-cultured for 3 d were incubated with the same
enzyme solution directly. After 3-4 h of incubation with
slow shaking (100 r/min), the mixture was filtered through
a 300-mmol/L mesh and centrifuged at 500 r/min for 5 min.
The protoplasts were then washed three times and resus-
pended in washing buffer (0.6 mol/L mannitol and 5 mmol/L
CaCl2, pH 5.8) to a density of about 106/mL. The two types
of wheat protoplasts (Cha 9 and 176) were mixed in a 1:1
ratio before fusion.
After isolation and purification, monolayer protoplasts
of wild millet were placed on 3 cm petri dishes, irradiated
by UV (50 W/m2) for 30 s, and mixed with the mixed wheat
protoplasts. Protoplast fusion and culture were carried out
as described by Xia et al. (1996). The following combina-
tions and controls were used in a series of experiments:Ⅰ.
Cha 9 (+) 176 (+) wild millet (UV 30 s); Ⅱ. Cha 9 (+) wild
millet（UV 30 s）; Ⅲ. 176 (+) wild millet（UV 30 s）;
Ⅳ. Cha 9 (+) 176; Ⅴ. wild millet（UV 30 s）.
1.2 Analysis of the hybrid nature of the regenerated
calli and plants
For chromosome counting, freshly regenerated calli and
root tips of the parents and putative hybrids were excised
and pre-treated as described by Xu et al. (2003). The pre-
treated material was transferred to a clean slide and
squashed to spread the chromosomes. Chromosome
spreads were stained by a standard acetocarmine method.
For peroxidase analysis, freshly regenerated callus was
homogenized in 1 mol/L Tris-HCl (pH 8.3) at a ratio of 1:2
(W/V), the mixture was centrifuged at 12 000 r/min for 10
min, then the supernatant was separated on 4%-10% gra-
dient polyacrylamide gels and stained following the pro-
tocol of Hu and Wan (1985).
Total DNA for PCR purposes was extracted from calli or
leaves of putative hybrids and parents using a modified
CTAB procedure. Eight RAPD primers were used to derive
amplicon profiles. PCR amplification was performed in 20
mL reactions containing: 1× PCR buffer, 200 mmol/L
dNTPs, 2.5 mmol/L MgCl2, 20 ng primer (Operon
Technology, USA); 1 U Ampli Taq polymerse and 50 ng of
genomic DNA. The PCR procedure consisted of a dena-
turation of 3 min at 94 ℃, followed by 43 cycles of 10 s at
94 ℃, 30 s at 36 ℃, and 50 s at 72 ℃. Finally, the samples
were kept at 72 ℃ for 7 min. Amplification products (8 mL)
were separated by electrophoresis on 1.5% agarose gels
in 1×TAE buffer and visualized with UV light after stain-
ing with ethidium bromide.
5S rDNA spacer sequences were amplified by primers
5 -G AG AGTAG TACAT CG AT G GG -3 a nd 5 -
GGAGTTCTGACGGGATCCGG-3 (Zhou et al., 1999). The
25 mL reactions contained 100 ng genomic DNA, 100
pmol/L of each primer, 200 mmol/L dNTPs, 2.5 mmol/L
MgCl2, 1 U Ampli Taq polymerse, 1× PCR buffer. The
amplification profile was (1) a denaturation step of 3 min at
94 ℃, (2) 35 cycles of 94 ℃ (1 min), 60 ℃ (1 min) and 72 ℃
(2 min), and (3) 72 ℃ (10 min). Reaction products (8 mL)
were electrophoresed on 2.5% agarose gels in 1× TAE
buffer and visualized under UV light after staining with
ethidium bromide.
For SSR analysis, seven pairs of common wheat chlo-
roplast SSR primers (listed in Table 1) were used. Amplifi-
cation was performed according to Ishii et al. (2001), and
the amplified products were electrophoresed in 6% poly-
acrylamide gels. Banding patterns were visualized using
Table 1 The sequence of the simple sequence repeat (SSR) primers
Locus Lo c a t i o n（g en e） Repeat Primer sequence (5→ 3)
WCt6 Intergenic region (C)10 TCACAGGCTGCAAAATTCAG
(trnC-rpoB) GGATAATAATGCTGTCGGACC
WCt7 coding region (A)12 ATCGTTCCCCACAAGACAAG
(ropC2) AGGGTTAAATGTTAAATGGGGG
WCt9 Intergenic region (T)12 CGCAGCCTATATAGGTGAATCC
(atpI-atpH) TTGCAACCAAGCAGATTATCC
WCt11 In tron (A)14 TTTTATCTAGGCGGAAGAGTCC
(atpF) TCATTTGGCTCTCACGCTC
WCt13 Intergenic region (A)15 TGAAAATCTCGTGTCACCA
(trnF-ndhJ) TGTATCACAATCCATCTCGAGG
WCt20 Coding region (T)10 TTCCATTGGGTAGGGCTTC
(infA) GTAATCGCCCCCGCCTATAGT
WCt23 Intergenic region (T)10 TCCAGAAAGAAAAACCGGG
(rpl14-rpl16) TAGCTGCCAGTAAAAATGCC
Acta Botanica Sinica 植物学报 Vol.46 No.9 20041116
silver staining, for which the gels were fixed in 10% (V/V)
glacial acetic acid for 30 min, washed for 2× 10 min in
double distilled water, incubated in 1 g/L AgNO3 and 1.5
mL/L 37% (V/V) HCOH in double distilled water for 30 min,
rinsed briefly in double distilled water, and stained in a
solution comprising 30 g/L Na2CO3, 1.5 mL/L 37% (V/V)
HCOH and 200 mL/L of 10 mg/mL Na2S2O3. Staining was
stopped by immersion in 10% (V/V) glacial acetic acid. The
gel was photographed after it had been dried at room
temperature.
2 Results
2.1 The regeneration of the callli and plants
The division and regeneration of fusions and controls
are presented in Table 2. The fusion product of controls Ⅳ
and Ⅴ did not divide and soon died. In combinations Ⅱ
and Ⅲ, calli regenerated but failed to form shoots. Only
the calli regenerated from combinationⅠ differentiated
into green plants. Five putative hybrids of 1.5-2.0 mm in
size were selected on the basis of faster growth (Zhou
et al., 2001) from the 14 regenerated small clones after 45 d
of culture. These were transferred onto proliferation me-
dium and later differentiation medium. The first green shoot
appeared about four months after fusion. Shoots were sub-
sequently transferred to NAA-containing medium for root
induction. After five months, 15, 17 and 40 green plantlets
were regenerated from clone numbers 1, 2 and 4
respectively, and all exhibited a wheat-like morphology
(Fig.1). The most vigorously growing rooted products of
clone 4 were transplanted into pots. Most of these plant-
lets survived transplantation, and some reached flowering.
These flowers had ovaries but lacked normal anthers, and
so were all self-sterile.
2.2 Analysis of somatic hybrids
2.2.1 Karyotpye As a result of long-term subculture, the
chromosome number of Cha 9 and 176 had fallen to 21-29
and 31-39, respectively, while that of wild millet ranged
from 21 to 42 (Fig.2). The chromosomes of the millet donor
are smaller than those of wheat, and we could therefore
distinguish the parental origin of chromosomes. Chromo-
some number in hybrids was determined for lines 1, 2 and
4: in calli, this fell in the range 40-52, while in root tips, the
range was 41-50. Two to several small chromosomes or
chromosome fragments were observed along with normal
chromosomes of wheat in some clones.
2.2.2 Isozyme The peroxidase patterns demonstrated
Fig.1. Regenerated plants from clone 4.
Table 2 Development of the fusion combinations and controls
Combinations/controls First division (d) Number of regenerated calli Morphology Plant differentiation
Ⅰ 5-6 14 T 1 72 green plants
Ⅱ 4-6 12 T 2 None
Ⅲ 8-10 4 S None
Ⅳ - None - None
Ⅴ - None - None
T1, 176; T2, Cha 9; S, wild millet.
CHENG Ai-Xia et al.: DNA Transfer from Wild Millet to Common Wheat by Asymmetric Somatic Hybridization 1117
that at least one specific gene product of each parental
species was represented on the profile of the regenerated
calli, and one novel product was expressed in clones 3, 4
and 5. It was clear that all the five selected vigorously
growing clones were hybrids at the biochemical level
(Fig.3).
2.2.3 5S rDNA spacer sequence The 5S rDNA spacer
analysis showed that both clones 3 and 5 carried DNA
from both fusion parents, while clones 1, 2 and 4 had a
pattern identical to that of wheat. In addition, all hybrid
clone profiles showed an identical band, not presented in
the profiles of either the donor or the recipient (Fig.4).
2.2.4 RAPD Eight RAPD primers used gave evidence
for hybrid characteristics (Table 3). Using primers OPA1,
OPA6, OPA17, OPA19 and OPF5, all the hybrid clones
analysed displayed RAPDs-specific for both parents,
thereby confirming their hybrid character (Fig.5). But in
some cases (OPA8, OPH20, OPF12), only wheat-specific
Fig.2. Chromosomes of hybrid lines 2, 4 and the parents (×600). a. Wild millet. b. Cha 9. c. 176. d, e. Somatic hybrid. Arrows, small
chromosomes; arrowheads, chromosomal fragments.
Fig.3. Peroxidase analysis of the regenerated calli from combi-
nation Ⅰ. Cha 9, 176, wheat; S, wild millet; 1, 2, 3, 4, 5, the
regenerated calli; <, band characteristic of wheat; arrowhead,
band characteristic of wild millet; arrow, new band; double-headed
arrow, band characteristic of Cha 9.
Fig.4. 5S rDNA electrophoresis pattern of PCR products. Cha
9, 176, wheat; S, wild millet; 1, 2, 3, 4, 5, the regenerated calli; M,
λDNA/ HindⅢ+ EcoRI molecular marker. <, the specific band
of wheat; arrowhead, the specific band of wild millet; arrow, new
band.
Acta Botanica Sinica 植物学报 Vol.46 No.9 20041118
profiles were detected in these clones, indicating an asym-
metric nature of the somatic hybrids. The plants derived
from clones 1, 2 and 4 also showed profiles from both par-
ents (Fig.6).
2.2.5 SSR Of the seven primer pairs tested, three
a new band in addition to all the bands characteristic of
wheat. The profiles of clones 1, 2 and 5 were all identical to
that of Cha 9 and 176, so that no wild millet characteristic
band was amplified by these three primer pairs. The Wct6
amplicon was derived from the wheat parent in all the
hybrids. These results suggest that although some sites
were mainly inherited from Cha 9 and 176, some recombi-
nation or co-existence within the chloroplast genome oc-
curred in the hybrids.
Evidence for the hybrid nature of clone 4 is summarized
in Table 4.
Table 3 RAPD analysis of regenerated calli
Primer OPA1 OPA8 OPA17 OPA19 OPA6 OPF5 OPH20 OPF12
calli1 P, N T P, N P P P T T
calli2 P T P, N P P P T T
calli3 P T P, N P, N P P T T
calli4 P, N T P, N P, N P P T T
calli5 P, N T P, N P, N P P T T
N, new band; P, band of parents; T, band of wheat.
Fig.5. RAPD profiles from calli of putative hybrids and their
parents, amplified by primer OPA6. S, wild millet; Cha 9, 176,
wheat; 1, 2, 3, 4, 5, the regenerated calli; M, λ DNA digested by
HindⅢ+EcoRⅠ molecular weight marker. <, band character-
istic of Cha 9 and 176; , band characteristic of wild millet; ←,
band characteristic of Cha 9; , band characteristic of 176.
Fig.7. Simple sequence repeat (SSR) analysis of regenerated calli. a. Amplicon from WCt6. b. Amplicon from WCt13. c. Amplicon
from WCt7. M, molecular marker; 1, 2, 3, 4, 5, regenerated clones; Cha 9, 176, wheat; S, wild millet; <, band characteristic of wheat;
arrow, band not present in either parent; arrowhead, characteristic band of wild millet.
Fig.6. RAPD profiles of putative hybrid plants and their
parents amplified by primer OPF 5. 1, 2, 4, hybrid plants from
clones 1, 2, 4, respectively; 177, wheat Jinan 177; S, wild millet;
M, λ DNA digested by HindⅢ +EcoRⅠ molecular weight
marker. <, band characteristic of Jinan 177; arrowhead, bands
characteristic of wild millet; arrow,amplicon not present in do-
nor or recipient.
(Wct6, Wct7, Wct13) amplified products which differenti-
ated the parents. The other primer pairs, were non-poly-
morphic with respect to the parents and all the hybrids.
The results of SSR analysis are shown in Fig.7. The clone
4 profile included bands characteristic of both parents at
the Wct13 locus, but for Wct7, clone 4 and clone 3 showed
CHENG Ai-Xia et al.: DNA Transfer from Wild Millet to Common Wheat by Asymmetric Somatic Hybridization 1119
3 Discussion
The performance of the regenerated calli was shown to
depend on the combination of parental cells utilized. It is
possible that combinations Ⅱ and Ⅲ failed to regenerate
green plants because of significant loss of chromosomes
from the Cha 9 (2n=21-29) cell line, and the chromosome
elimination of 176; while combinationⅠwas able to gen-
erate green plants via complementation of the genomes of
the parents. This method has already been utilized in the
successful somatic hybridization of Cha 9 (+) 176 (+)
Haynaldia villosa (Zhou et al., 2002), where it was con-
sidered that the protoplasts of Cha 9 played the role of
nurse cells. In the combination Cha 9 (+) 176 (+) maize, it
was also shown that hybrids contained genetic material
from both Cha 9 and 176. The RAPD polymorphisms be-
tween 176 and Cha 9—both these cell lines are descended
from the variety Jinan 177-identified by certain primers
(e.g. OPA6) may be the result of somaclonal variation in-
duced by long-term culture. Although clones 1, 2 and 4 all
had nuclear DNA profiles from Cha 9, 176 as well as wild
millet, only the clone 4 results suggest the occurrence of
recombination and genome co-existence within the
chloroplast. Significantly, many vigorous green plants were
able to be regenerated from this clone, suggesting a comple-
mentary effect of the parent nuclear together with chloro-
plast genomes.
In flowering plants, the transmission of chloroplasts is
generally uniparental. Chiu and Sears (1985) suggested that
the apparent lack of recombination between cpDNAs is a
reflection of a lack of plastid fusion. However, chloroplast
genes, or their interactions with nuclear genes, are impli-
cated in the control of several morphological,
physiological, and agronomic traits in plants, and may be
involved in the differentiation and development of hybrid
plants as shown in this experiment. Thus protoplast fu-
sion offers an opportunity for interspecific gene transfer
by bringing together chloroplasts of divergent origin into
a hybrid cell and allowing recombination to occur. In ear-
lier investigations, most authors have reported the ran-
dom or equal distribution of cpDNA in somatic hybrids
(Haridng et al., 2000; Yamagishi et al., 2002). Recombina-
tion and co-existence of cpDNAs were also observed in
somatic hybrids of barley (+) carrot (Kisaka et al., 1997),
Trachystoma ballii (+) B. juncea (Baldev et al., 1998). In
our experiment, seven pairs of SSR primers were used to
analyze the cpDNA of the regenerated calli. At the Wct13
and Wct7 loci, cpDNA of the somatic hybrids between
common wheat and wild millet exhibited co-existence and
recombination, while in some clones the chloroplast ge-
nome seemed to have been derived exclusively from the
wheat parent. Compared our result with that of direct visu-
alization of restricted organellar DNA or Southern analy-
sis with labeled probes (Zhou et al., 2001), amplification of
cpDNA with SSR primers, followed by electrophoresis of
amplified fragments, is a simpler, more rapid and less ex-
pensive method to determine the genomic origin of or-
ganelles in somatic hybrids of wheat.
In the earlier experiments, we demonstrated that chro-
mosome elimination and fragmentation were caused by UV
irradiation in the asymmetric somatic hybridization (Xiang
et al., 2003). It was also reported that the degree of asym-
metry was mainly determined by the phylogenetic rela-
tionship and hence the extent of somatic compatibility of
the fusion parents, rather than by the dose of irradiation
applied to the donor parent. Therefore, highly asymmetric
somatic hybrids were more likely to occur in remote combi-
nations (Liu et al., 1999). From the morphological observa-
tions and nuclear analysis above, we conclude that the
somatic hybrids obtained in this study were highly
asymmetric. We assume that this was determined by both
the usage of UV on the donor parent and by the distant
phylogenetic relationship between wheat and wild millet.
The somatic hybrid plants obtained in the present study
were sterile, although some regenerants were able to flower.
The sterility was perhaps related to chromosomal
Table 4 Identification of hybrid clone 4 and its regenerated plants
Chr. No. Isozyme RAPD 5S rDNA
SSR
Wct7 Wct13
Calli 4 40-52 T1+S T1+T2+S+(N) T+N (T1=T2)+N (T1=T2)+S
Cha 9 (T1) 21-29 T 1 T 1 T 1 T 1 T 1
176 (T2) 31-39 T 2 T 2 T 2 T 2 T
Wild millet (S) 30-42 S S S S S
Plants from calli 4 41-50 - T+S - - -
Jinan177 (plants) 42 - T - - -
Wild millet plants (S) 42 - S - - -
N，new band; S，wild millet; T1, 176; T2, Cha 9.
Acta Botanica Sinica 植物学报 Vol.46 No.9 20041120
incompability resulting from the distant phylogenetic rela-
tionship that existed between wheat and wild millet. In
addition it might also be a consequence of the many years
that the material used had been in culture, in which regen-
eration potential and fertility were both reduced. A further
possibility was that plantlet age prior to transplantation
was too long. We therefore intend to attempt transplanta-
tion of younger regenerants, obtained from ovary-derived
calli, and to obtain seeds through artificial pollination and
embryo-rescue methods.
In this study, we have obtained a novel combination of
nuclei and organelles after remote related protoplast fu-
sion with the system of two types of wheat protoplasts as
recipient. This system may have important applications
on the transfer of useful nuclear/cytoplasmic genes from
wild grasses into wheat. In addition, somatic hybridization
may represent a very practical system to study the influ-
ence of the nuclear genome over the organellar one.
Acknowledgements: We are grateful to Dr. Robert
Koebner (John Innes Centre, UK) for language correction.
References:
Baldev A, Gaikwad K, KirtiT P B, Mohapatra T, Prakash S,
Chopra V L. 1998. Recombination between chloroplast ge-
nomes of Trachystoma ballii and Brassica juncea following
protoplast fusion. Mol Genet Genomics, 260: 357-361.
Chiu W L, Sears B B. 1985. Recombination between chloroplast
DNAs does not occur in sexual crosses of Oenothera. Mol
Genet Genomics, 198: 525-528.
Haridng K, Millam S. 2000. Analysis of chromatin, nuclear DNA
and organelle composition in somatic hybrids between
Solanum tuberosum and Solanum sanctae-rosae. Theor Appl
Genet, 101: 939-947.
Hu N-S , Wan G-X . 1985. Application of isozyme Technique.
Changsha: Hunan Science and Technology Publisher. 96-
104. (in Chinese)
Ishii T, Mori N, Ogihara Y. 2001. Evaluation of allelic diversity
at chloroplast microsatellite loci among common wheat and
its ancestral species. Theor Appl Genet, 103: 896-904.
Kisaka H, Kisaka M, Kanno A, Kameya T. 1997. Production
and analysis of plants that are somatic hybrids of barly
(Hordeum vulgar L.) and carrot (Daucus carota L.). Theor
Appl Genet, 94: 221-226.
Li L-L, Xia G-M, Chen H-M. 2001. Asymmetric hybridization
between wheat and millet. Acta Physiol Sin, 27: 455-460.
Li Z Y, Xia G M, Chen H M. 1992. Somatic embryogenesis
and plant regeneration from protoplast isolated from
embryogenic cell suspension of wheat (Triticum aestivum
L.). Plant Cell Tiss Org, 28: 72-85.
Liu B, Liu Z, Li X W. 1999. Production of a highly asymmetric
somatic hybrid between rice and Zizania latifolia (Griseb.):
evidence for inter-genomic exchange. Thero Appl Genet, 98:
1099-1103.
Xia G M, Chen H M. 1996. Plant regeneration from intergeneric
somatic hybridization between Triticum aestivum L. and
Leymmus chinensis (Trin) Tzvel. Plant Sci, 120: 197-203.
Xiang F N, Xia G M, Chen H M. 2002. Asymmetric somatic
hybridization between wheat (Triticum aestivum L.) and
Avena sativa L. Sci China (Ser C), 32: 299-305.
Xiang F N, Xia G M, Chen H M. 2003. Effect of UV dosage on
somatic hybridization between common wheat (Triticum
aestivum L.) and Avena sativa L. Plant Sci, 164: 697-707.
Xiang F-N , Xia G-M, Zhou A-F, Chen H-M. 1999. Aysmmetric
somatic hybridization between wheat (Triticum aestivum)
and Bromus inermis. Acta Bot Sin , 41: 458-462. (in Chinese
with English abstract)
Xu C H, Xia G M, Zhi D Y, Xiang F N, Chen H M. 2003.
Integration of maize nuclear and mitochondrial DNA into the
wheat genome through somatic hybridization. Plant Sci, 165:
2004-2008.
Yamagishi H, Landgren M, Forsberg J, Glimelius K. 2002. Pro-
duction of asymmetric hybrids between Arabidopsis thaliana
and Brassica napus utilizing an efficient protoplast culture
system. Theor Appl Genet, 104: 959-964.
Zhou A F, Xia G M，Chen H M. 2001. Comparative study of
intergeneric symmetric and asymmetric somatic hybridiza-
tion between Triticum aestivum L. and Haynaldia villosa.
Sci China (Ser C), 44: 294-304.
Zhou A-F, Xia G-M , Chen X-L, Chen H-M . 2002. Production
of somatic hybrid plants between two types of wheat proto-
plasts and the protoplasts of Haynaldia villosa. Acta Bot Sin
, 44: 1004-1008.
Zhou A, Xia G, Zhang X, Chen H, Hu H. 2001. Analysis of
chromosomal and organellar DNA of somatic hybrids be-
tween Triticum aestivum and Haynaldia Villosa Schur. Mol
Genet Genomics, 265: 387-393.
Zhou A-F, Xu C-H, Xiang F-N , Xia G-M, Chen H-M. 1999.
Study on the identification of somatic hybrids by PCR with
5S rDNA spacer sequence primers. Chin J Biotechnol , 15:
529-532. (in Chinese with English abstract)
(Managing editor: ZHAO Li-Hui)