全 文 ：Received 7 Jan. 2004 Accepted 5 Jul. 2004
Supported by the State Key Basic Research and Development Plan of China (2002CB412306), the Project of The Chinese Academy of
Sciences (KSCXZ-1-10) and the Frontier Science Project Programmes of the Institute of Hydrobiology, The Chinese Academy of Sciences
(220316).
* Author for correspondence. E-mail: .
http://www.chineseplantscience.com
Acta Botanica Sinica
植 物 学 报 2004, 46 (11): 1373-1382
Cloning and Characterization of the Gene for UDPGlc Dehydrogenase
from the Cyanobacterium, Microcystis aeruginosa FACHB 905
LEI La-Mei1, 2, SONG Li-Rong1*
(1. State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology,
The Chinese Academy of Sciences, Wuhan 430072, China;
2. Graduate School of The Chinese Academy of Sciences, Beijing 100039, China)
Abstract: Using degenerate primers based on conserved regions of the UDP-glucose dehydrogenase
(UDPGDH) gene, an initial 476-bp DNA fragment was amplified from the water-bloom forming cyanobacterium,
Microcystis aeruginosa FACHB 905. TAIL-PCR and ligation-mediated PCR were used to amplify the flanking
regions to isolate an about 2.5-kb genomic DNA fragment. Sequence analysis revealed an ORF encoding a
putative 462 amino acid protein, designated Mud for Microcystis UDPGDH. The Mud amino acid sequence
is closely related to UDPGDH sequences from cyanobacterium Synechocystis PCC6803 (73% identity, 81%
similarity), and bacterium Bacillus subtilis (51% identity and 67% similarity). The cloned mud gene was
expressed in Escherichia coli using the pGEX-4T-1 fusion expression vector system to generate a GST-
Mud fusion protein that exhibited UDPGDH activity. The cytosolic fraction of M. aeruginosa FACHB 905
was subjected to Western analysis with an anti-Mud antibody, which revealed a single band of approximately
49 kD, consistent with the deduced molecular mass of the enzyme. The Mud protein could thus be
characterized as a UDP-glucose dehydrogenase, which was a key enzyme for polysaccharide synthesis and
has, for the first time, been studied in algae.
Key words: Microcystis ; UDP-glucose dehydrogenase; TAIL-PCR; gene expression
The prokaryotic freshwater cyanobacterial Microcystis,
a single-celled blue-green alga, often forms dense water-
blooms in eutrophic lakes and ponds, where colonies em-
bedded in a mucilaginous matrix can form large floating
masses. The extensive production of mucilage and the tox-
icity of some species can make Microcystis blooms a
nuisance. Acidic polysaccharides are the major components
of the mucilage, along with the only acidic component, ga-
lacturonic acid ( Nakagawa et al., 1987; Martin et al., 1989;
Plude et al., 1991; Forni et al., 1997). The synthesis of UDP-
galacturonic acid, the precursor of polysaccharide
synthesis, has been extensively studied in bacteria
(Dougherty et al., 1993; Kereszt et al., 1998), plants
(Robertson et al., 1996; Tenhaken and Thulke, 1996;
Johansson et al., 2002; Turner and Botha, 2002) and mam-
mals (Hempel et al., 1994; Spicer et al., 1998) including
humans, but has never been reported in algae.
Despite an important role of Microcystis mucilage
polysaccharide in bloom-formation, almost nothing is
known about genes encoding components of the relevant
pathways in algae. As shown in Fig.1, many sugars are
derived from UDP-glucuronic acid, which is a central
intermediate in the nucleotide sugar interconversion path-
way (Kereszt et al., 1998; Seitz et al., 2000). Of the nucle-
otide sugars produced by this pathway, UDP-galacturonic
acid accounts for 28%-83% of the biomass of a typical
Microcystis mucilaginous polysaccharide bloom
(Nakagawa et al., 1987). Therefore, it was hypothesized
that UDPGDH, the enzyme that converts UDP-glucose to
UDP-glucuronic acid, may be a key enzyme in synthesis of
Microcystis mucilaginous polysaccharides. As a first step
towards the elucidation of this possible mechanism, we
cloned and characterized the UDPGDH gene from M.
aeruginosa FACHB 905.
1 Materials and Methods
1.1 Cyanobacterial and bacterial strains and plasmids
Microcystis aeruginosa strains FACHB 905 was ob-
tained from the Freshwater Algae Culture Collection of the
Institute of Hydrobiology (FACHB). Escherichia coli
strains JM109 and TG1 were used for cloning, expression
and DNA manipulations. The pGEM-T vector (Promega)
was used for cloning and sequencing. The GST-fusion vec-
tor pGEX-4T-1 was kindly provided by Dr. WU Ying-Song
Acta Botanica Sinica 植物学报 Vol.46 No.11 20041374
(The First Military Medical University in Guangzhou), and
restriction endonucleases and other enzymes were mainly
purchased from TaKaRa Biotechnology Co., Ltd.
1.2 Media and growth conditions
E. coli was cultured in LB medium at 37 ℃, with 60
mg/L ampicillin. Microcystis was grown in MA medium at
28 ℃ at 50 E.m-2.s-1 with continuous illumination.
1.3 Construction of degenerate PCR primers and PCR
conditions
The forty known UDPGDH genes, including those of
Synechocystis PCC6803, Anabaena PCC7120 (Nostoc
PCC7120), Thermosynechococcus elongatus BP-1, Bacil-
lus subtilis, Zymomonas mobilis, Sinorhizobium meliloti,
etc., are 77% to 26% similar at the deduced amino acid level.
By aligning the amino acid sequence of these genes, two
highly conserved regions were identified (GTGYVG and
EFLREG) and converted into DNA sequences using
cyanobacterium Synechocystis PCC6803 preferred codons
(Table 1). The PCR reactions were performed in 50 mL reac-
tion volumes that included 50 ng of genomic DNA, 200
mmol/L dNTPs, 0.4 mmol/L of each degenerate primer, 1.5
mmol/L MgCl2 and 2 U of Taq polymerase. Thermal cycling
consisted of 32 cycles of the following: 94 ℃ for 30 s; 48 ℃
for 40 s; and 72 ℃ for 1 min (GeneAmp PCR system 2400;
Perkin Elmer). PCR products were electrophoresed using
0.9% agarose gels and visualized by staining with ethidium
bromide. The products were gel-purified and subjected to
direct sequencing.
1.4 Cloning flanking regions
TAIL-PCR was used to determine the sequences of the
3 flanking region. This technique consists of consecutive
PCRs performed with nested sequence-specific primers and
a shorter arbitrary degenerate primer. Degenerate primer
A2 was synthesized along with three nested primers (UD1,
UD2 and UD3) corresponding to sequences at the 3 end of
the gene (Table 1). The primary TAIL-PCR reaction mixture
(20 mL) contained 1×Ex Taq buffer, 200 mmol/L dNTPs,
0.25 mmol/L UD1, 3 mmol/L AD2, 10 ng of total DNA, and 1
U of Ex Taq. Thermal cycling was performed on a GeneAmp
PCR system 9600 (Perkin Elmer). For secondary reactions,
1-mL aliquots of 50-fold diluted primary TAIL-PCR prod-
ucts were added to 20-mL PCR reaction mixtures containing
Fig.1. The central role of UDPGDH played in capsule and other
polysaccharides synthesis. KPS, capsule polysaccharide; LPS,
lipopolysaccharide.
Table 1 PCR primers used in this work
Primers Sequence(1) (5-3)
Degenerate primers
DP1 GGAACGGGATATGAGGT
DP2 CCCTTCTCGCAAAAATTC
TAIL-PCR primers
UD1 GACAATCCCCCATCTATGAACCG
UD2 GGATTGGGTACGGATGATCG
UD3 GGTGGTTCGCCGGTGCTCTAA
AD2(2) NGTCGASWGANAWGAA
Primers for ligation-PCR
UD4 CTTCCACATAACGGGTGTCACT
UD5 CGGTTCATAGATGGGGGATTGTC
Primers used for expression
MD1 CCTGTCGACATGCGTGTTTGTGTTATCGGA
SalⅠ
MD2 CTCGCGGCCGCTTAACGTCCGATCCCGAGGT
NotⅠ
(1), N = A,T,G or C;S = C or G; W = A or T; (2), using the method of Liu and Whittier (1995).
LEI La-Mei et al.: Cloning and Characterization of the Gene for UDPGlc Dehydrogenase from the Cyanobacterium,
Microcystis aeruginosa FACHB 905 1375
the above ingredients with primers UD2 and AD2. One-
microliter aliquots of 10-fold diluted secondary TAIL-PCR
products were then added to tertiary PCR reaction mixtures
(20 mL) containing the above ingredients with primers UD3
and AD2.
The 5 flanking regions were cloned with the TaKaRa
LA PCR in vitro Cloning Kit according to the manufacturer’s
recommendations, using gene-specific primers UD4 and
UD5 (Table 1).
The final PCR products were separated using 0.9% aga-
rose gels to confirm amplification of a single tertiary product,
which was then gel-purified, ligated into pGEM-T and
sequenced.
1.5 DNA sequence analysis and alignments
Sequence similarity searches were carried out using the
EMBL/GenBank databases. The molecular mass and puta-
tive amino acid sequence of Mud was inferred with
DNAMAN 4.0 (Dr. SHI Wen-Yuan, School of Dentistry Uni-
versity of California at Los Angeles). A multiple alignment
of UDPGDH amino acid sequences from various prokary-
otic organisms was constructed with the software package
Clustalw1.82 from online sequence analyzing tools of The
Institute Pasteur (http://bioweb.pasteur.fr/seqanal/dna/
intro-uk.html).
1.6 Expression of the UDPGDH gene and enzyme activity
assay
The complete coding region of the mud gene of M.
aeruginosa FACHB 905 was PCR-amplified from genomic
DNA using MD1 and MD2 primers, which contained a
SalⅠ and NotⅠ sites, respectively. The resulting PCR
product was cloned into the pGEX-4T-1 high-expression
vector that had been digested with the restriction enzymes
SalⅠ and NotⅠ. The recombined plasmid pGU1 was in-
troduced into E. coli TG1, which was then grown in LB and
induced with 1 mmol/L IPTG from 3-8 h. The appropriate
time of induction was determined using SDS/PAGE.
The induced cells were harvested, washed twice with
phosphate-buffered saline (PBS) and resuspended in the
same buffer. The cells were broken by sonication and the
supernatant was subject to an enzyme activity assay in
which UDPGDH was spectroscopically measured using a
modification of previous methods (Macro et al., 1999). In
brief, 10 mmol/L Tris-HCl (pH 8.5), 1 mmol/L NAD+ and 15
mL of lysate were placed in a 0.1 mL cuvette. When the
absorbance at OD340 was stabilized, 10 mL of 50 mmol/L
UDP-Glc was added. The reduction of NADH was mea-
sured as an OD increase at 340 nm. The positive control
was UDPGDH from purified bovine liver (Sigma) and the
negative control was E. coli TG1 with pGEX-4T-1 alone.
1.7 Western blotting analysis
In order to confirm the expression of UDPGDH in M.
aeruginosa FACHB 905, the GST-Mud fusion protein was
purified by gel slitting and used to create a polyclonal
GST-Mud antibody. The crude extract of M.aeruginosa
FACHB 905 was subjected to SDS-PAGE and transferred
to nylon-membrane. The obtained antiserum was used
for Western blotting analysis according to standard
protocols.
2 Results
2.1 Sequence of the mud gene
Using a combination of conventional PCR, TAIL-PCR
and ligation-PCR, we obtained the complete sequence for
the mud gene of M. aeruginosa FACHB 905 (Fig.2). The
ORF consisted of 1 386 bp encoding a putative polypep-
tide of 461 amino acid residues with a calculated molecular
mass of 49.4 kD. The DNA G + C content was 48%, which is
higher than the average level of 39%-49%.The mud gene
sequence has been submitted to the EMBL/GenBank/DDBJ
databases with the accession number AA084900.
2.2 DNA sequence analysis and alignment
A database search showed that Mud possessed a strik-
ingly high identity to the UDPGDH protein of Synechocystis
PCC6803 (Slr1299; 81% similarity, 73% identity) as well as
those of Anabaena PCC7120 (Alr0658, 86% and 77%) and
Thermosynechococcus elongatus BP-1 (Tll0664, 81% and
74%). The high identity between UDPGDHS and various
cyanobacteria suggested strict structural requirements for
proper functioning of the protein. Another possibility of
the high identity may be due to the fact that evolutionary
time is not enough for the cyanobacterial UDPGDH to di-
verge significantly. In order to further examine the similarity,
these UDPGDH sequences were aligned (Fig.3). One highly
conserved region was found at all five N-termini, where a
motif associated with NAD binding sequence (GXGXXG)
was apparent (Spicer et al., 1998). UDPGDH from eukary-
otic organisms displayed less similarity to the correspond-
ing Microcystis sequence (Table 2), but the degree of
Table 2 Comparison of derived aa sequence of Microcystis
UDPGDH to the corresponding proteins from eukaryotic sources
UDPGDH source Identity (%) Similarity (%)
Rat 35 50
Human 35 51
Bovine liver 35 50
Fruitfly 32 51
Soybean 32 49
Arabidopsis 32 49
Poplar 31 48
Acta Botanica Sinica 植物学报 Vol.46 No.11 20041376
Fig.2. Nucleotide and deduced amino acid sequences.
LEI La-Mei et al.: Cloning and Characterization of the Gene for UDPGlc Dehydrogenase from the Cyanobacterium,
Microcystis aeruginosa FACHB 905 1377
Fig.3. Alignment of UDPGDH sequences from Synechocystis PCC6803, Nostoc PCC7120, Thermosynechococcus elongatus BP-1,
Microcystis aeruginosa and Bacillus subtilis. Amino acids that are identical in the five genes are indicted by asterisks and those that are
physico-chemically similar are indicated by dots. Dashes in the sequences represent gaps introduced to maximize alignment. The
consensus NAD binding sequence (GXGXXG) and the proposed catalytic cysteine residue (C) are underlined.
Acta Botanica Sinica 植物学报 Vol.46 No.11 20041378
identity (approximately 31% and higher) still sug-
gested considerable structure/function restrains for the
overall UDPGDH aa sequence.
2.3 Expression of the M. aeruginosa FACHB 905 mud
gene in E. coli and enzyme activity
E. coli TG1 cells were transformed with recombinant
Fig.3. (continued).
LEI La-Mei et al.: Cloning and Characterization of the Gene for UDPGlc Dehydrogenase from the Cyanobacterium,
Microcystis aeruginosa FACHB 905 1379
plasmid pGU1 to express the cloned gene; 3-4 h exposure
to 1 mmol/L IPTG was found to induce sufficient quantities
of the fusion protein (Fig.4). Low-level expression was
observed in uninduced cells (Fig.4, lane 2). The molecular
mass of the fusion protein was ~75 kD as estimated by
comparison with the protein markers. GST itself is 26 kD, so
the Mud protein was estimated to be 49 kD, which is in
good agreement with the expected size of 49.4 kD. The cells
were broken by sonication and both sediment and super-
natant were used for SDS-PAGE (data not shown). Most of
the fusion protein segregated with the insoluble fraction
but part of them was present in the soluble fraction, which
was used for the UDPGDH assay without further
purification.
As previously (Sieberth et al., 1995), we directly tested
recombinant GST-Mud protein expression in E.coli for
UDPGDH activity , which we assessed by monitoring the
reduction of NAD+ at 340 nm in the presence of UDP-
glucose. The results (Fig.5) showed that the expressed fu-
sion protein increased 340 nm in a manner and degree simi-
lar to those of purified bovine liver UDPGDH after addition
of the UDP-glucose substrate. Negative control cells con-
taining empty pGEX-4T-1 did not record enzyme activity,
providing evidence that the recombinant Mud protein acts
as a UDPGDH.
2.4 Western blotting analysis
Western blotting analysis with anti-GST-Mud revealed
a single band of about 49 kD that was in good agreement
with the molecular weight (49.4 kD) deduced from the nucle-
otide sequence of the mud gene (Fig.6). This showed that
M.aeruginosa FACHB 905 did produce a Mud protein.
As reported above, sequence alignment analysis and
enzymatic activity assay have suggested that Mud might
be a UDPGDH, the protein product of Microcystis FACHB
905 mud gene was UDPGDH.
3 Discussion
Chromosomal DNA of the genus Microcystis is ex-
tremely resistant to many restriction endonucleases, and
restriction analysis has revealed the presence of dam-like
and/or dcm-like methylases in these cyanobacteria. These
technicalities have complicated the development of
Microcystis molecular biology (Nakagawa et al., 1987;
Fig.4. SDS-PAGE of GST-Mud expressed in Escherichia coli
TG1. Lane 1, molecular mass markers; lane 2, crude extract
from E.coli TG1 transformed with pGEX-4T-1; lanes 3-8,
crude extracts from recombinants induced by IPTG for 1-6 h,
respectively.
Fig.5. Enzyme assay for UDPGDH activity. Positive control
beef liver UDPGDH was purchased from Sigma (□), experimen-
tal recombinant Mud (◇) and negative control cells contained the
vector plasmid alone (D).
Fig.6. Western blotting analysis of cytosolic fractions from
Microcystis aeruginasa FACHB 905.
Acta Botanica Sinica 植物学报 Vol.46 No.11 20041380
Padhy et al., 1988), and frustrated our use of inverse PCR
(Ochman et al., 1988) and tailing PCR (Gubin et al., 1999) in
Microcystis work. Screening of genomic Microcystis DNA
libraries (Sakamoto et al., 1993; Sato et al., 1996) is of use,
and has allowed the cloning of the microcystin synthetic
gene cluster, mcyABCDEFGHIJ (Nishizawa et al., 1999;
Tillett et al., 2000), but this process is time- and labor-inten-
sive for cloning of target genes. Here, we use the recently
developed method TAIL-PCR to clone the flanking regions
of our target gene. This technique is relatively simple and
results in little or no background amplification, and may be
generally applicable for amplifying DNA sequences from
cyanobacterial genomes.
UDPGDH is present in many prokaryotes and eukary-
otic tissues where it catalyzes the formation of UDP-GlcUA
(UDP-glucuronic acid) in all organisms (Kereszt et al., 1998;
Seitz et al., 2000), though there is a second pathway in
plants. Figure 1 summarizes the central role of UDPGDH in
UDP-sugar formation and various polysaccharide
syntheses. Uronic acid can be epimerized to UDP-GalUA
(UDP-galacturonic acid) by UDP-GlcUA-4-epimerase, or
converted into other monosaccharides such as xylose and
arabinose, which can be incorporated into the Microcystis
mucilage. This strongly suggests that UDPGDH is neces-
sary for the production of mucilage.
Therefore, we sought to clone the UDPGDH gene of M.
aeruginosa FACHB 905. The resultant mud gene contains
a 1 386-bp ORF with a G + C content of 48.26 mol%. Mud
has a high degree of gene and protein similarity to the other
cyanobacteria UDPGDH gene (Fig.3).This similarity sug-
gests that our cloned gene acts as the M.aeruginosa
UDPGDH. To confirm its identity by biochemical means,
we expressed mud as a GST-tagged fusion protein and used
this GST-Mud fusion protein for an enzyme activity assay.
Antibodies directed against the purified fusion protein rec-
ognized a single 49-kD band in M.aeruginosa FACHB 905
total proteins (Fig.6), which is consistent with the expected
size.
The Mud sequence contains an apparent cofactor bind-
ing site for NAD, which is characteristic of NAD-linked
dehydrogenases. Similar to many other identified
UDPGDHs, the Mud NAD-binding site is found at the N-
terminus of the protein. Among UDPGDHs, the bovine liver
UDPGDH is best characterized. It contains the amino acid
sequence ASVGFGGSCFZZGK (where Z corresponds to
glutamic acid or glutamine) at its active center (Franzen et
al., 1981; Carlos et al., 1994). According to aligned se-
quences (Fig.3), a similar sequence (GGSCFPKD) was found
in Mud, as was an active site Cys similar to that found in
the bovine UDPGDH. BLAST analysis showed that the
DNA upstream of mud contains an ORF similar to the gene
encoding dTDP-glucose 4,6-dehydratase, which is respon-
sible for cell envelope synthesis in Anabaena PCC7120
(Nostoc PCC7120) and Thermosynechococcus elongatus
BP-1. This type of genetic organization of UDPGDH and
dTDP-glucose 4,6-dehydratase is consistent across these
three cyanobacteria. In prokaryotes, function-related genes
are almost always clustered, therefore, the regions flanking
mud gene should be an envelope-synthesis gene cluster
and participate in the formation of the mucilage polysac-
charide of Microcystis.
References:
Asayama M, Tanaka K, Takahashi H, Sato A, Aida T, Shirai M.
1996. Cloning, sequencing and characterization of the gene
encoding a principal sigma factor homolog from the
cyanobacterium Microcystis aeruginosa K-81. Gene, 181:
213-217.
Carlos A, Rubens L, Ernesto G. 1994. Molecular characterization
of cap3A, a gene from the operon required for the synthesis of
the capsule of Streptococcus pneumoniae type 3: sequencing
of mutations responsible for the unencapsulated phenotype
and localization of the capsular cluster on the pneumococcal
chromosome. J Bacterial, 176: 6375-6383.
Dougherty B, Ivo van de Rijin I. 1993. Molecular characteriza-
tion of hasB from an operon required for hyaluronic acid syn-
thesis in group A Streptococci. J Biol Chem, 268: 7118-7124.
Forni C, Telò F R, Caiola M G. 1997. Comparative analysis of
the polysaccharides produced by different species of
Microcystis (Chroococcales, Cyanophyta). Phycologia, 36:
181-185.
Franzen B, Carrubba C, Freingold D S, Ashcom J, Franzen J S.
1981. Amino acid sequence of the tryptic peptide containing
the catalytic-site thiol group of bovine liver uridine diphos-
phate glucose dehydrogenase. Biochem J, 199: 599-602.
Gubin A N, Kodurn S, Njoroge J M, Bhatnagar R, Miller J L.
1999. Restriction cutting independent method for cloning ge-
nomic DNA segments outside the boundaries of known
sequences. BioTechniques, 27: 1170-1177.
Hempel J, Perozich J, Romovacek H, Hinich A, Kuo I, Feingold
D S. 1994. UDP-glucose dehydrogenase from bovine liver:
primary structure and relationship to other dehydrogenases.
Protein Sci, 3: 1074-1080.
Johansson H, Sterje F, Amini B, Lundeberg J, Kleczkowski L A.
2002. Molecular cloning and characterization of a cDNA
LEI La-Mei et al.: Cloning and Characterization of the Gene for UDPGlc Dehydrogenase from the Cyanobacterium,
Microcystis aeruginosa FACHB 905 1381
encoding poplar UDP-glucose dehydrogenase, a key gene of
hemicellulose/pectin formation. Biochim Biophys Acta, 1576:
53-58.
Kereszt A, Ernö K I, Reuhs B L, Carlson R W, Ádám Kondoros
I, Péter P. 1998. Novel rkp gene clusters of Sinorhizobium
meliloti involved in capsular polysaccharide production and
invasion of the symbiotic nodule: the rkpK gene encodes a
UDP-glucose dehydrogenase. J Bacterial, 180: 5426-5431.
Liu Y G, Whittier R F. 1995. Thermal asymmetrrtric interlaced
PCR: automatable amplification and sequencing of insert end
fragments from P1 and YAC clones for chromosome walking.
Genomics, 25: 674-681.
Macro P, Vladimir L, Blazenka S, Dimitri K. 1999. Assay for
UDPglucose 6-dehydrogenase in phosphate-starved cells: gene
tuaD of Bacillus subtilis 168 encodes the UDP glucose 6-
dehydrogenase involved in teichuronic acid synthesis.
Microbiology, 145: 1049-1053
Martin C, Codd G A, Siegelman H W, Weckesser J. 1989. Li-
popolysaccharides and polysaccharides of the cell envelope
of toxic Microcystis aeruginosa strains. Arch Microbiol, 152:
90-94.
Nakagawa M, Takamura Y, Yagi O. 1987. Isolation and character-
ization of the slime from a cyanobacterium Microcystis
aeruginosa K-3A. Agr Biol Chem, 51: 329-337.
Nishizawa T, Asayama M, Fujii K, Harada K, Shirai M. 1999.
Genetic analysis of the peptide synthetase for a cyclic
heptapeptide microcystin in Microcystis spp. J Biochem, 126:
520-529.
Ochman H, Gerber A S, Hartl D L. 1988. Genetic applications of
an inverse polymerase chain reaction. Genetics, 120: 621-
623.
Padhy R N, Hottat F G, Coene M M, Hoet P. 1988. Restriction
analysis and quantitative estimation of methylated bases of
filamentous and unicellular cyanobacterial DNAs. J Bacterial,
170: 1934-1939.
Plude J L, Parker D L, Schommer O J, Timmerman R J, Hagstrom
S A, Joers J M, Hnasko R. 1991. Chemical characterization of
polysaccharide from the slime layer of the cyanobacterium
Microcystis flos-aquae C3-40. Appl Environ Microbiol, 57:
1696-1700. (Managing editor: ZHAO Li-Hui)
Robertson D, Smith C, Bolwell G P. 1996. Inducible UDP-
glucose dehydrogenase from French bean (Phaseolus vulgaris
L.) lacates to vasular tissue and has alcohol dehydrogenase
activity. Biochem J, 313: 311-317.
Sakamoto T, Shirai M, Asayama M, Aida T, Sato A, Tanaka K,
Takahashi H, Nakano M. 1993. Characteristics of DNA and
multiple rpoD homologs of Microcystis (Synechocystis) strains.
Int J Syst Bacterial, 43: 844-847.
Sato M, Shibato J, Aida T, Asayama M, Shirai M. 1996. Light-
responsive and rhythmic gene expression of psbA2 in
cyanobacterium Microcystis aeruginosa K-81. J Gen Appl
Microbiol, 42: 381-391.
Seitz B, Klos C, Wurm M, Tenhaken R. 2000. Matrix polysac-
charide precursors in Arabidopsis cell walls are synthesized
by alternate pathways with organ-specific expression patterns.
Plant J, 21: 537-546.
Seki M, Ito T, Shibata D, Shinozaki K. 1999. Regional insertional
mutagenesis of specific genes on the CIC5F11/CIC2B9 locus
of Arabidopsis thaliana chromosome 5 using the Ac/Ds
transposon in combination with the cDNA scanning method.
Plant Cell Physiol, 40: 624-639.
Sieberth V, Rigg G P, Robert R I, Jann K. 1995. Expression and
characterization of UDPGlc dehydrogenase (KfiD), which is
encoded in the type-specific region 2 of the Escherichia coli
K5 capsule genes. J Bacterial, 177: 4562-4565.
Spicer A P, Kaback L A, Smith T J, Seldin M F. 1998. Molecular
cloning and characterization of the human and mouse UDP-
glucose dehydrogenase genes. J Biol Chem, 273: 25117-25124.
Tenhaken R, Thulke O. 1996. Cloning of an enzyme that synthe-
sizes a key nucleotide-sugar precursor of hemicellulose bio-
synthesis from soybean: UDP-glucose dehydrogenase. Plant
Physiol, 112: 1127-1134.
Tillett D, Dittmann E, Erhard M, Von Dören H, Börber T, Neilan
B A. 2000. Structural organization of microcystin biosynthe-
sis in M.aeruginasa PCC7806: an integrated peptide-
polyketide synthetase system. Chem Biol, 7: 753-764.
Turner W, Botha F C. 2002. Purification and kinetic properties of
UDP-glucose dehydrogenase from sugarcane. Arch Biochem
Biophys, 407: 209-216.