全 文 ：Received 10 May 2003 Accepted 26 Aug. 2003
Supported by the Hi-Tech Research and Development （863） Program of China (2001AA212051) and the National Special Program
for Research and Industrialization of Transgenic Plants (JY03-A-13).
* Author for correspondence. E-mail: .
http://www.chineseplantscience.com
Acta Botanica Sinica
植 物 学 报 2004, 46 (6): 751-756
Cloning of Plastid Acetyl-CoA Carboxylase cDNA from Setaria italica
and Sequence Analysis of Graminicide Target Site
ZHAO Hu-Ji1, WANG Jian-Hua1, GAO Peng1, GU Ri-Liang1, ZHANG Jing-Qiang1,
WANG Tian-Yu2, WANG Guo-Ying1*
(1. State Key Laboratory of Agrobiotechnology and National Center for Maize Improvement, China
Agricultural University, Beijing 100094, China;
2. Institute of Crop Germplasm Resources, The Chinese Academy of Agricultural Sciences, Beijing 100081, China)
Abstract: Acetyl-CoA carboxylase (ACCase) is a biotinylated enzyme that catalyzes the first committed
step in fatty acid biosynthesis. Graminaceous ACCase in plastid is the target site of two classes of
graminicide herbicides. Two full-length cDNAs of plastid ACCase from sethoxydim-resistant and sensitive
Setaria italica Beauv., named foxACC-R and foxACC-S, have been cloned. cDNA sequencing showed that
they encode a protein of 2 321 amino acids long with a pI of 5.89 and a calculated molecular mass of 256
kD. The sequences of foxACC-R and foxACC-S have been compared with their homologs from other plants
and analyzed for conserved amino acid regions and their functional domains. It is found that the amino acid
at position 1 780 is Leu in foxACC-R other than Ile in foxACC-S and other cereal plastid ACCase. It is
suspected that the change of Ile to Leu residue is critical for interaction of plastid ACCase with cereal
herbicides APPs and CHDs. According to Southern hybridization, foxACC-R and foxACC-S are both
estimated to be single copy in the genome of S. italica.
Key words: Setaria italica; Acetyl-CoA Carboxylase; cloning; herbicide; target site
Acetyl-CoA carboxylase (ACCase; EC 6.4.1.2) is a
biotinylated enzyme that catalyzes the first committed step
in fatty acid biosynthesis and provides malonyl-CoA for
the synthesis of a variety of important secondary metabo-
lites and for malonylation (Brownsey et al., 1997; Herbert
et al., 1997). In plants, these primary and secondary meta-
bolic pathways are located in different compartments. It
has been shown that plants have two forms of ACCase.
One of them locates in plastids, the primary site of plant
fatty acid synthesis, which is a “prokaryotic-type”
multisubunit enzyme, and contains four subunits: a biotin
carboxyl carrier protein (BCCP), a biotin carboxylase (BC),
and two subunits of a carboxy transferase (CT). Another
plant ACCase locates in cytoplasmsol, which is a “eukary-
otic-type” multifunctional enzyme containing all four of the
prokaryotic subunits in a single chain, in the order of BC,
BCCP, CTb and CTa. But there is an exception, Graminae
ACCases in plastids and in cytoplasmsol all belong to eu-
karyotic type (Alban et al., 1994; Konishi and Sasaki, 1994;
Gornicki et al., 1997; Zhao and Wang, 2003).
Recently, plant ACCases have attracted particular at-
tention because graminae ACCase in plastid is the action
site of two chemically dissimilar classes of graminicide:
a r y l o x y p h e n o x y p r o p i o n a t e s ( A P P s ) a n d
cyclohexanediones (CHDs). The basis of selectivity for
these graminicide lay in the structure of the plastid ACCase.
The herbicides reduce ACCase activity in meristematic, as
a result, inhibit de novo fatty acid biosynthesis and cause
plant death in sensitive plants. It has been reported that
graminae ACCase in plastid is sensitive to these
graminicides, but dicots and nongraminaceous monocots
ACCase exhibits less sensitive to them (Herbert et al., 1997;
Christoffers et al., 2002). A recent report indicated that the
sensitive enzyme has an Ile residue, and the resistant one
has a Leu residue at the putative herbicide-binding site.
Additionally, a single Ile to Leu replacement at an equiva-
lent position changes the wheat plastid ACCase from the
sensitive to resistant (Zagnitko et al., 2001).
A foxtail millet (Setaria italica ) line Chum BC6-1, which
is highly resistant to sethoxydim, has been developed by
distant hybridization (Wang and Darmency, 1997). In this
paper, we report the cloning of the full-length cDNA of
foxtail millet plastid ACCases from Chum BC6-1 and wild
lines and the comparison of their amino acid sequences.
Acta Botanica Sinica 植物学报 Vol.46 No.6 2004752
1 Materials and Methods
1.1 Plant materials
Seeds of sethoxydim-resistant foxtail millet ChumBC 6-1
and wild line Sda 11were from the Institute of Crop
Germplasm Resources, The Chinese Academy of Agricul-
tural Sciences.
1.2 Methods
1.2.1 RNA isolation Total RNA was isolated from 2-
week-old foxtail millet using Trizol reagent (Invitrogen)
according to the manufacturer’s protocol.
1.2.2 RACE Total RNA of foxtail millet seedling was
reverse-transcribed, and the cDNA ends of foxACC were
amplified using “System for Rapid Amplification of cDNA
Ends” (Invitrogen). The 5 RACE/3 RACE gene-specific
primers (Table 1) were designed according to known con-
servative regions of graminae plastid ACCase cDNAs. The
PCR products were cloned into pGEM-T Easy Vector
(Promega) and sequenced.
1.2.3 Cloning the full-length cDNA of foxACC
THERMOSCRIPTTMRT-PCR System (Invitrogen) was used
to reverse transcribe the first strand of foxACC cDNA. One
mL of the above cDNA was used for amplification by PCR
with Advantage cDNA PCR Kit (Clontech). After denatured
at 94 ℃ 2 min, the PCR reaction was carried out for 30
cycles as follows: 94 ℃ 15 s, 68 ℃ 8 min, followed by a 7
min final extension at 68 ℃. The full-length primer (Table 1)
was designed based on the sequence obtained by the 5
RACE/3 RACE. The PCR products were cloned into TOPO
XL PCR Cloning Kit (Invitrogen).
1.2.4 Sequence analysis and comparison of foxACC with
its homologs Some internet and biology softwares were
used to analyze foxACC sequences, which include OMIGA,
DNAMAN, BLAST, http://www.cbs.dtu.dk/services/
TargetP/, psort.nibb.ac.jp, http://www.ncbi.nlm.nih.gov/
Structure/ and so on.
1.2.5 Southern blotting analysis Genomic DNA of
foxtail millet was extracted from leaves by using the method
of SDS (Fu et al., 1994). About 20 mg of genomic DNA was
digested with 40 U of restriction endonucleases (Promega)
at 37 ℃ overnight. The digested DNA was separated by
electrophoresis on 0.8% of agarose gel and blotted on
Hybond-N+ nylon membrane (Amersham Pharmacia) in 0.4
mol/L NaOH. Probe was random-primed labeled with
[a-32P] dCTP. Southern hybridization was carried out over-
night at 42 ℃. The hybridized filters were washed in 2×
SSC, 0.5% SDS at 42 ℃ for 30 min, twice in 1×SSC, 0.1%
SDS at 65 ℃ for 30 min, twice in 2×SSC at 65 ℃ for 10 min,
and exposed to X-ray film (Fuji) at -70 ℃.
2 Results
2.1 Cloning of foxACC full-length cDNAs
The first 5 RACE generated three bands (about 1 000
bp, 750 bp and 420 bp) in sethoxydim-resistant foxtail millet,
but only one band (380 bp) in wild foxtail millet (Fig.1a).
Sequencing of the longest three bands revealed that all
these products showed high homology to known
graminae plastid ACCase cDNA, especially to that of
maize, but the start codon and 5 UTR sequence of ACCase
gene could not be found. The second 5 RACE and 3
RACE generated a single band both in sethoxydim-re-
sistant and susceptible foxtail millet as we suspected
(Fig.1b, c). Based on the sequences of two 5 RACE and
3 RACE, A DNA band of about 7.3 kb containing the
complete ORF has been obtained from both foxtail millet
(Fig.1d).
After assembling the sequences from RACE and RT-
PCR, we obtained the full length cDNA sequence of ACCase
gene from sethoxydim-resistant S. italica, designated as
foxACC-R, which has 7 446 bp and includes an ORF of
6 966 bp, 58 nucleotides of 5 untranslated sequence (UTR)
and 422 nucleotides of 3 UTR (accession number:
AY219175). The full-length cDNA sequence from
sethoxydim-sensitive S. italica, designated as foxACC-S,
has 7 271 bp and includes an ORF of 6 966 bp, 26 bp of 5
UTR and 279 nt of 3 UTR (accession number: AY219174).
Both genes are deduced to encode a protein of 2 321 amino
acids with an pI of 5.89 and molecular weight ca. 256 kD.
There are eight amino acids difference between foxACC-R
and foxACC-S.
Table 1 Primers of RACE and full-length cDNA amplification
Experiment Primer Sequence (5 to 3)
The first 5 RACE GSP1 CCCACAGCCTTAGCAAGCCT
GSP2 GATCACAAAGCAACTGAACTTCAAG
The second 5 RACE GSP3 TTGCTGCTGCCATTCCATTG
GSP4 GTCTGCCATTATGTGCTTCATTTAC
3 RACE GSP5 CCAGGTCAGCTTGATTCCCATGAG
Full-length amplification FLL TGTGCTGTCTGGGCTACGGAACGAC
FLR CAGAATTGAACCGCTGGTTACATCACATAACTA
ZHAO Hu-Ji et al.: Cloning of Plastid Acetyl-CoA Carboxylase cDNA from Setaria italica and Sequence Analysis of Graminicide
Target Site 753
2.2 Comparison of the cloned cDNA with reported plant
ACCase
According to our BLAST results, it is confirmed that
the cloned cDNA from foxtail millet encoded plastid ACCase.
The amino acid sequence encoded by foxACC-R showed
91% and 84% identity with the plastid ACCase from Zea
mays and Triticum aestivum, respectively, but only 64%-
69% identity with the cytosolic ACCase from Triticum
aestivum and other plants (Table 2).
only 33.1%. Another software also predicted the likelihood
of 83.9% for the cloned foxtail ACCase locating in plastids
(www.inra.fr/predotar/).
There are four conservative domains among the foxtail
ACCase (Fig.2), which are commonly existed in eukaryotic
ACCase (Gornicki et al., 1994; Egli et al., 1995). The biotin
carboxylase domain is located at amino acid position 132-
634. Within the domain, there are three most conserved
regions, carbamoyl-phosphate synthase L chain N-termi-
nal region(132-254), ATP binding region（256-487）
and biotin carboxylase C-terminal region（527-634）.
The biotin carboxyl carrier domain is found at amino acid
position 770-838 and the highly conservative biotinylation
site EVEVMKM is located at amino acid position 801-807
within this domain. It has been shown previously that ap-
proximately 30 amino acid residues on each side of the con-
sensus sequence are important for biotinylation in vivo
(Elborouga et al., 1996). The b- and a-domains of the CT
are located at amino acid positions 1 638-1 707 and 1 936-
2 191, respectively, which is the most conserved domains
among the four domains. The highly conserved
carboxybiotin binding site（1 658-1 707）and the
acetyl-CoA-binding site（1 946-1 965）play an impor-
tant role in this domain.
2.3 Analysis of graminicide target site
There are eight amino acid differences between
sethoxydim-resistant and sensitive foxtail ACCase. Com-
pared with amino acid sequence of other eukaryotic
ACCases, we could find an interesting correlation (Fig.3).
At amino position 1 780, sethoxydim-resistant foxtail is Leu
(codon TTA), but sethoxydim-sensitive Ile (codon ATA).
Most graminaes sensitive to APPs and CHDs are also found
Fig.1. Product of 5 RACE/3 RACE and full-length cDNA amplification. a. The first 5 RACE. b. The second 5 RACE. c. 3 RACE.
d. Full-length cDNA amplification. M, DNA marker; R, sethoxydim-resistant foxtail; S, sethoxydim-sensitive foxtail.
Table 2 Comparison of the amino acid sequence deduced from
foxACC-R with reported eukaryotic-type ACCase of plants
Species Location
Identity Accession
(%) number
Zea mays Plastid 91 U19183
Triticum aestivum Plastid 84 AF029895
Cytosolic 69 U39321
Arabidopsis thaliana Cytosolic 67 L27074
Brassica napus Cytosolic 64 Y10301
Medicago sativa Cytosolic 67 L25042
Glycine max Cytosolic 68 L42814
It is found that the foxtail ACCase has about 100 amino
acids in N-terminal sequences that are rich in hydroxylated
amino acids Ser and Thr, containing multiple small hydro-
phobic residues such as Ala and Val, and positively charged
amino acids such as Arg and Lys. These features are char-
acteristic of many transit sequences (Schleiff and Soll, 2000).
The transit peptides also have a characteristic Met-Ala se-
quence at their N termini. Analysis of the protein-sorting
signals (http://www.cbs.dtu.dk) predicted that the prob-
ability of chloroplast transit peptide in the foxtail ACCase
was 94.3%, and that of mitochondrial targeting peptide was
Acta Botanica Sinica 植物学报 Vol.46 No.6 2004754
Ile in the site in their plastidic eukaryotic ACCase. All di-
cots and nongraminaceous monocots, which are resistant
to the herbicides, have Leu at the position of prokaryotic
ACCases and cytosolic, eukaryotic ACCase. Graminaes
cytosolic ACCase, animals and yeast ACCase are eukary-
otic and have Leu in this position, which are not sensitive
to these herbicides. From these results and analysis, we
concluded that the change of Leu from Ile residue is critical
for the interaction of ACCase with APPs and CHDs. The
result is consistant with Zagnitko et al. (2001) and Délye et
al. (2002).
2.4 Southern blotting/hybridization analysis of foxtail
millet genomic DNA
To investigate the copy number of foxACC, genomic
DNA of foxtail millet was digested with EcoRⅠ, SacⅠ,
EcoRV, SphⅠ, Bgl Ⅱ, SpeⅠand KpnⅠ respectively, sepa-
rated on 0.8% agarose gel and transferred to nylon mem-
brane (Hybond-N+). Two probes were used for the
hybridization. One probe was a 400 bp fragment from 5
coding region of plastid ACCase cDNA, which encoded
chloroplast transit peptide sequence and was lack in cyto-
solic-ACCase cDNA. Another probe was a 1.4 kb fragment
from biotin carboxylase domain, which has the highest iden-
tity (79%) with cytosolic ACCase cDNA. The hybridiza-
tion bands for the above two probes were almost identical
(Fig.4). These results support the view that there is only
one copy for the foxACC in foxtail millet. The identity be-
tween plastid and cytosolic ACCase cDNA is not so high
Fig.2. The conserved amino acid domains and regions of foxACC. A, carbamoyl-phosphate synthase L chain N-terminal region; B, ATP
binding region; C, biotin carboxylase C-terminal region; D, biotin carboxyl carrier domain; E, Ctb domain; F, Cta domain.
Fig.3. Alignment of the amino acid sequence of the CT domain of eukaryotic-type ACCase where an isoleucine/leucine substitution was
found in resistant sethoxydim Setaria italica. The isoleucine residue is indicted in bold. ACCase sequences were obtained from GenBank,
accession No. from top to bottom: AY219175, AY219174, U19183, AF359513, AF359514, U10187, AF029895, X99102, AF072737,
L27074, X77576, L25042, L42814, AF330145, Z46886, L20784, P78820, M92156, Y15996, S41121, J03541, J03808, Q28559,
AJ132890. *, the isoleucine residue.
ZHAO Hu-Ji et al.: Cloning of Plastid Acetyl-CoA Carboxylase cDNA from Setaria italica and Sequence Analysis of Graminicide
Target Site 755
as having cross hybridization.
3 Discussion
ACCase has been identified as an important regulatory
enzyme for plant fatty acid synthesis by three diverse in
vivo approaches. Analysis of substrate and product pool
sizes implicated the role of ACCase in the light/dark regula-
tion of fatty acid synthesis in spinach leaves (Post-
Beittenmiller et al., 1992) and chloroplasts (Post-
Beittenmiller et al., 1991; Akiko et al., 2000). Herbicide inhi-
bition of ACCase was used to determine flux control
coefficients, and led to the conclusion that ACCase exerts
major control over fatty acid synthesis rates in barley and
maize (Page et al., 1994; Herbert et al., 1997). ACCase was
also the apparent site of feedback inhibition of fatty acid
synthesis in tobacco suspension cells supplemented with
exogenous fatty acids (Shintani and Ohlrogge, 1995). But,
the molecular mechanism of this regulation is unknown until
now. Cloning the full-length cDNA of foxtail plastid ACCase
will lay a basis for the understanding of the molecular mecha-
nism in this process. Moreover, the full-length cDNA of
the foxACC-R can be introduced into graminaceous crops
to confer herbicide resistance, the overexpression of the
foxACC-R is also likely to lead to an increase in the oil
content of the plants and seeds.
Although the isoleucine/leucine residue substitution is
critical for the interaction of ACCase with APPs, leucine
and isoleucine have similar chemical structures. Herbert et
al. (1996) studied the reaction kinetics and herbicide bind-
ing characteristics of the two isoforms of maize ACCase
from plastid and cytosol, which have Leu and Ile respec-
tively at the herbicide binding site. The result showed that
their molecular masses, native conformations and Michae-
lis constants for three substrates were all rather similar.
Moreover, the reaction characteristics were close to an or-
dered mechanism in both cases. However, there is a small
stereochemical change at the herbicide-binding site, includ-
ing the critical Leu/Ile residue, which may alter the enzyme-
inhibitor interaction. Therefore, perhaps other residues
might also play a role in defining the binding site of ACCase
with herbicides (Zagnitko et al., 2001).
References:
Alban C, Baldewt P, Douce R. 1994. Localization and character-
ization of two structurally different forms of acetyl-CoA car-
boxylase in young pea leaves, of which one is sensitive to
aryloxyphenoxypropionate herbicides. Biochem J, 300: 557-
565
Brownsey R W, Zhande R, Boone A N. 1997. Isoforms of acetyl-
CoA carboxylase: structures, regulatory properties and meta-
bolic functions. Biochem Soc T, 25: 1232-1238.
Christoffers M J, Berg M L, Messersmith C G. 2002. An isoleu-
cine to leucine mutation in acetyl-CoA carboxylase confers
herbicide resistance in wild oat. Genome, 45: 1049-1056.
Délye C, Wang T, Darmency H. 2002. An isoleucine-leucine sub-
stitution in plastid acetyl-CoA carboxylase from green foxtail
(Setaria viridis (L.) Beauv.) is responsible for resistance to
the cyclohexanedione herbicide sethoxydim. Planta, 214:
421-427.
Egli M A, Lutz S M, Somers D A, Gegenbach B G. 1995. A maize
acetyl-coenzyme A carboxylase cDNA sequence. Plant Physiol,
108: 1299-1300.
Elborouga K M, Winz R, Deka R K, Markham J E, White A J,
Rawsthorne S, Slabas A R. 1996. Biotin carboxyl carrier Pro-
tein and carboxyltransferase subunits of the multi-subunit form
of acetyl-CoA carboxylase from Brassion napus: cloning and
analysis of expression during oilseed rape embryogenesis.
Biochem J, 315: 103-112.
Fu R-Z, Sun Y-R, Jia S-R. 1994. Plant Genetic Transformation.
Beijing: China Science and Technology Press. 131-137. ( in
Chinese)
Gornicki P, Podkowinshi J, Scappino L A, DiMaio J, Ward E,
Haselkorn R. 1994. Wheat acetyl-coenzyme A carboxylase
cDNA and protein structure. Proc Natl Acad Sci USA, 91:
6860-6864.
Gornicki P, Faris J, King I, Podkowinshi J, Gill B, Haselkorn R.
1997. Plastid-localized acetyl-CoA carboxylase of bread wheat
is encoded by a single gene on each of the three ancestral
Fig.4. Southern hybridization analysis of foxtail millet genomic
DNA. The probe was from 5 coding region of plastid ACCase
cDNA, which encoded chloroplast transit peptide sequence. Lanes
1 to 7, foxtail millet genomic DNA digested with EcoRⅠ, SacⅠ,
EcoR V, SphⅠ, BglⅡ, SpeⅠ and KpnⅠ, respectively.
Acta Botanica Sinica 植物学报 Vol.46 No.6 2004756
(Managing editor: ZHAO Li-Hui)
chromosome sets. Proc Natl Acad Sci USA, 94: 14179-14184.
Herbert D, Price L J, Alban C, Dehaye L, Job J, Cole D J, Pallett
K E, Harwood J L. 1996. Kinetic studies on two isoforms of
acetyi-CoA carboxylase from maize leaves. Biochem J, 318:
997-1006.
Herbert D, Walker K A, Price L J, Cole D J, Pallett K E, Ridley S
M, Harwood J L. 1997. Acetyl-CoA carboxylase — a
graminicide target site. Pestic Sci, 50: 67-71.
Konishi T, Sasaki Y. 1994. Compartmentalization of two forms
of acetyl-CoA carboxylase in plants and the origin of their
tolerance toward herbicides. Proc Natl Acad Sci USA, 91:
3598-3601.
Kozaki A, Kamada K, Nagano Y, Iguchi H, Sasaki Y. 2000. Re-
combinant carboxyltransferase responsive to redox of pea
plastidic Acety-CoA carboxylase. J Biol Chem, 275: 10702-
10708.
Page R A, Okada S, Harwood J L. 1994. Acetyl-CoA carboxylase
exerts strong flux control over lipid synthesis in plants. Biochim
Biophys Acta, 1210: 369-372.
Post-Beittenmiller D, Jaworski J G, Ohlrogge J B. 1991. In vivo
pools of free and acylated acyl carrier proteins in spinach:
evidence for sites of regulation of fatty acid biosynthesis. J
Biol Chem, 266: 1858-1865.
Post-Beittenmiller D, Roughan G, Ohlrogge J B. 1992. Regula-
tion of plant fatty acid biosynthesis analysis of acyl-coen-
zyme A and acyl-acyl carrier protein substrate pools in spin-
ach and pea chloroplast. Plant Physiol, 100: 923-930.
Schleiff E, Soll J. 2000. Travelling of proteins through membranes:
translocation into chloroplasts. Planta, 211: 449-456.
Shintani D K, Ohlrogge J B. 1995. Feedback inhibition of fatty
acid synthesis in tobacco suspension cells. Plant J, 7: 577-
587.
Wang T, Darmency H. 1997. Inheritance of sethoxydim resis-
tance in foxtail millet, Setaria italica (L.) Beauv. Euphytica,
94: 69-73.
Zagnitko O, Jelenska J, Tevzadze G, Haselkorn R, Gornicki P.
2001. An isoleucine/leucine residue in the carboxyltransferase
domain of acetyl-CoA carboxylase is critical for interaction
with aryloxyphenoxypropionate and cyclohexanedione
inhibitors. Proc Natl Acad Sci USA, 98: 6617-6622.
Zhao H-J, Wang G-Y. 2003. Molecular biology and gene engi-
neering of plant acetyl-CoA carboxylase. J Chin Biotechnol,
23: 12-16. （in Chinese with English abstract）