全 文 ：Received 25 Feb. 2004 Accepted 5 Jul. 2004
Supported by the Hi-Tech Research and Development (863) Program of China (G2001AA222101, G2001AA212011) and National Special
Project for Cotton Development from Agricultural Ministry of the Chinese Government.
* Author for correspondence. Tel: +86 (0)10 62136406; Fax: +86 (0)10 62133692; E-mail: .
http://www.chineseplantscience.com
Acta Botanica Sinica
植 物 学 报 2004, 46 (12): 1424-1433
Structural Characteristic and Genetic Expression of nodulin-like
Gene and Its Promoter in Cotton
REN Mao-Zhi1, CHEN Quan-Jia1, 2, ZHANG Rui1, GUO San-Dui1*
(1. The Biotechnology Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, China;
2. Agronomy Department of Xinjiang Agricultural University, Urumqi 830052, China)
Abstract: Full-length DNA, cDNA and promoter sequences of nodulin-like gene have been isolated and
characterized by isocaudarner inverse PCR (Ⅱ-PCR) and rapid isolating cDNA 5 unknown sequence and
promoter (RICUP) methods from cotton. Sequence analysis indicated that nodulin-like gene was 2 353 bp
in size, including five introns and six exons. Its full-length cDNA was 1 480 bp, containing an 1 125-bp ORF
structure, which encoded a 40.23-kD polypeptide with predicted isoelectric point of 8.433. A check against
nr database in GenBank indicated that no DNA sequence was found to share homology with it. Searched in
EST database, a 733-bp EST sequence of Gossypium arboreum L. (GenBank asscession number BF271235)
was found to share 92% homology with it. Promoter of nodulin-like gene was 1 969 bp in length with several
typical sequences, such as initiator, TATA box, CAAT-like box and AT-rich sequence. Southern blotting
analysis suggested that one copy of nodulin-like gene was integrated into cotton genome. Northern
blotting analysis showed that nodulin-like gene expressed preferentialy in fiber and reproductive organs of
cotton, such as bud, flower and boll. Our work provides researchers with candidate genes to improve
agronmic traits of cotton and also provide efficient expression elements for problem solving in transgenic
Bt cotton, namely resistance to bollworm declining dramatically at late developmental stage of cotton.
Key words: nodulin-like gene; promoter; structural characteristic; genetic expression; cotton
Cotton is a kind of important cash crops in the world.
China is the world biggest cotton-producing country. And
cotton has played crucial role in national economy (Jia
et al., 2001). Great success being made in transgenic Bt
cotton indicates promising future in improvement of cot-
ton varieties by ways of genetic engineering (Jia et al.,
2001). Therefore, by ways of molecular biology, researches
deciphering the events during the cause of cotton devel-
opment have been carried out briskly, such as gene expres-
sion controlling, interactions among genes and relation-
ship between gene and phenotype. Ultimately, these re-
searches will lay solid foundation for qualities improve-
ment of cotton varieties existed by genetic engineering (Guo
et al., 2003).
Cotton productivities are subjected directly to its repro-
ductive organ that is also closely related to agronomic prop-
erty of cotton, such as fertility, quality of fiber. Therefore,
developmental biology of cotton reproductive organ has
become a hotspot in the field of cotton molecular biology
(Jia et al., 2001). During development of cotton reproduc-
tive organs, about 10 000 genes are reported to express
specifically (Jia et al., 2001). However, cotton is an allotet-
raploid plant, with 56 chromosomes, making its genome a
huge one. Therefore, it is relatively difficult to isolate full-
length DNA, cDNA and expression controlling elements of
target gene from cotton, such as promoter and enhancer.
By far, only dozens of genes, which can express specifi-
cally or preferentially in cotton reproductive organ, have
been cloned and identified (Zhao et al., 2001; Hou et al.,
2002; Ulloa et al., 2002; Ji et al., 2003; Suo et al., 2003;
Zhang et al., 2003) and only a few promoters have been
cloned (John and Petersen, 1994; Rinehart et al., 1996; Liu
et al., 2000; Luo et al., 2002; Sunilkumar et al., 2002). Genes
expressing specifically in reproductive organ function vi-
tally in economic productivities of cotton, especially in con-
struction of fiber properties and qualities, such as length,
strength and finess. Thus, studies on genes specifically
expressed in cotton reproductive organs and isolation of
related gene, promoter and specific expression elements of
genes would be of great help for acknowledgement of mo-
lecular mechanisms of fertility, fiber development and pro-
ductivity formation of cotton.
Nodulin is a gene family of scores of family members,
which express specifically in nodule and participates in
control of formation, growth and development of root nod-
ules in plants (Rhijn et al., 1997; Hohnjec et al., 2000, Laplaze
REN Mao-Zhi et al.: Structural Characteristics and Genetic Expression of nodulin-like Gene and Its Promoter in Cotton 1425
et al., 2000; Becker et al., 2001; Sousa et al., 2001). Mem-
bers of this family are reported to express at different stages
of root nodule formation (Mathis et al., 1999; Fruhling et
al., 2000; Staehelin et al., 2001).
For the first time, the full-length cDNA of nodulin-like
gene, which expressed preferentialy in fiber and cotton
reproductive organs, and promoter were isolated from
Gossypium hirsutum Guo Y18 by means of isocaudarner
inverse PCR (Ⅱ-PCR) and rapid isolating cDNA 5 unknown
sequence and promoter (RICUP). Structure, genetic
expression of nodulin-like gene and functional
characteristics of nodulin-like protein and promoter were
identified.
1 Materials and Methods
1.1 Template DNA
Cotton (Gossypium hirsutum Guo Y18) genomic DNA
was extracted from cotton leaves by modified CTAB method
(Huang et al., 2000), and was used for DNA amplification,
chromosome walking in unknown flanking sequence and
Southern blotting analysis.
1.2 Template RNA
Total RNA was extracted from 7-10 dpa fiber in G.
hirsutum Guo Y18 by improved hot borate method (Wan et
al., 1994), and was used for cDNA amplification, unknown
cDNA walking and Northern blotting analysis.
1.3 Reagents and kits
DIG high prime DNA labeling and detection starter Kit
Ⅱ was purchased from Roche Co., Ltd.; Taq DNA Poly-
merase and RNA PCR Kit (AMV), Ver.2.1 Kit were purchased
from TaKaRa Biotech (Dalian, China) Co., Ltd.; DNA Isola-
tion Kit was from BioDeV Co., Ltd.; DNA restriction en-
zymes used were from Promage Co., Ltd.; other related re-
agents were purchased from Sigama Co., Ltd. Sequencing
was carried out by BIOSIA Co., Ltd. (Shanghai).
1.4 Isocaudarner inverse PCR (Ⅱ-PCR)
In this study, great improvements have been made on
inverse PCR (Ⅰ-PCR), resulting in establishment of Ⅱ-PCR.
isocaudarner inverse PCR (Ⅱ-PCR). Therefore, successive
chromosome walking can be carried out successfully in
higher eukaryotic organisms with huge genomes. During
performance of Ⅰ-PCR, it is difficult to obtain DNA frag-
ments of less than 4 kb, resulting in unsuccessful amplifi-
cation of target DNA. As we know, most of commonly used
restriction enzymes have isocaudarners, with both of which
genomic DNA can be cut into fragments of less than 4 kb.
Thus, fragments are circularized easily and amplifications
of target fragments are carried out efficiently (Sambrook et
al., 1989).
1.5 Technique on rapid isolation of unknown cDNA
sequence in 5 end and promoter
Using Ⅱ-PCR, DNA 5 flanking sequence was
obtained, with which isolation of unknown cDNA in 5 end
was carried out. Exons in 5 flanking sequence were cap-
tured using bioinformatic program. Primers for cDNA walk-
ing in 5 end were designed based on putative exons
sequences. Then, cDNA walking was performed till full-
length 5 cDNA of target gene was obtained. Thus, 5 termi-
nus of cDNA was targeted on genomic DNA. Combination
with analysis of upstream sequence, such as initiator, TATA
box, CAAT box and GC box, potential position of promoter
was determined (Weaver, 2002).
1.6 PCR primers designing
PCR primers were designed (Table 1) using DNAStar/
primerselect.
1.7 Bioinformatic tool used for result analyses
NCBI/GenBank/Blast and DNAStar.
1.8 Southern blotting and Northern blotting analyses
Consult molecular cloning (Sambrook et al., 1989) and
merchant’s instructions for procedures.
2 Results
2.1 Obtainment of 4 506 bp full-length nodulin-like gene
from cotton chromosome
Based on sequences of ADP-ribosylation-factor 1 (arf1)
gene and its promoter cloned in our laboratory①, chromo-
some walking was performed upstream known sequence
by isocaudarner inverse PCR (Ⅱ-PCR). In the first round of
Ⅱ-PCR walking, BamHⅠ (an isocaudarner of Bgl Ⅱ) was
selected to digest genomic DNA. A 2 925-bp fragment was
amplified from circularized product (Fig.1A), with DF1and
DR1 (Table 1) as primer pairs. Sequencing result showed
that DNA sequence was advanced towards 5 end by 1 987
bp (Fig.1C). In the second round of Ⅰ-PCR, BclⅠ (an
isocaudarner of BglⅡ) was used for DNA digestion.
However, no band was amplified from circularized product
with DF2 and DR2 as paired primers (Table 1). Therefore,
Ⅱ-PCR was performed alternatively, using BglⅡ (an
isocaudarner of BclⅠ) to digest above product. A 2 661-
bp product was amplified from circularized DNA segments
(Fig.1B). Subtracting 1 589 bp overlapped sequence, DNA
walking was performed towards 5 terminus by 1 072 bp
(Fig.1C). Taken together, sequence was advanced towards
5 end by 3 059 bp through two rounds of Ⅱ-PCR. Thus, a
4 506-bp DNA sequence was obtained from cotton genome,
① Arf1 gene was closely linked to nodulin-like gene (the work on
arf1 gene was submitted to Acta Genet Sin in our another paper).
Acta Botanica Sinica 植物学报 Vol.46 No.12 20041426
including 1 447 bp fragment upstream arf1 gene promoter
sequence.
2.2 Bioinformatic analysis of 4 506 bp cotton genomic
DNA sequence and exons capture in this region
First, 4 506 bp sequence was searched in NCBI/GenBank.
However, no identical sequence was found in nr database/
GenBank. When it was checked against EST database, an
EST sequence from fiber cDNA library of G. arboreum
(accession number BF271235) was found to share high
homology with it. Bases 1-54 in EST sequence were about
92% identical with those of 1 935-1 988 in 4 506 bp sequence,
while bases 55-170 in EST fragment shared 95% identity
with those of 3 132-3 249 in the DNA sequence; bases
171-577 in EST sequence shared about 92% homology
with bases 3 338-3 740 from this 4 506 bp sequence; bases
588-733 of EST sequence was about 86% identical to those
of 3 865-4 010 in this DNA sequence obtained. These clues
indicated that the 4 506 bp fragment might be involved in
cotton fiber development. Fragments sharing high homol-
ogy with EST sequences were speculated to be exons while
Table 1 PCR primers used in this work
Experiment types Primer sequences (5→ 3)
Chromosome walking Forward primers DF1: GGTTTATGTATGATGTATCTTTCAG
DF2: TTTCGTTGCTTCAAGTTTTGTTTT
Reverse primers DR1: TAGTCCCGTCCGATTCCATTATCC
DR2: GGTACTTTTCCCCTCTGTGTTA
cDNA walking of nodulin-like gene Forward primers CF1: TCATCGGCATAGGTGAATCC
CF2: GGTTTCTAAGAAA CAACAGGAAA
CF3: AATCTTTGCCACCCTCGCCATTGCT
CF4: AGTGGTGGTAATATCGGCTCTAA
CF5: ATTTCGTTG CTTCAAGTTTTG
CF6: TTCCCATAATATAACACCAAC
CF7: CTTCATTTCATAAGTGTCTTTTCTC
Reverse primers CR1: TCTCAAAAATGATACA AATCGATA
Oligo (dT18): TTTTTTTTTTTTTTTTTT
Northern blot probe amplification Forward primers NPF1: GTTCCCACATATAGCTTCTCACGA
Reverse primers NPR1: AAAGCCAGTCCAGTCCCTCATACA
Southern blot probe amplification Forward primers SPF1: TTCTTGGCCAATGTTCTGC
Reverse primers SPR1: CCCTGAAAGATACATCATAC
Fig.1. Agarose gel elecrophoresis analysis of amplified products and scheme of chromosome walking on DNA sequence upstream 5
terminus of arf1 gene by Ⅱ-PCR. M, GeneRulerTM 1 kb DNA Ladder Mix was used as a size marker. A. The first round of Ⅱ-PCR
walking (laneⅠ). B. The second round of Ⅱ-PCR (lane Ⅱ). C. Scheme of chromosome walking procedure by Ⅱ-PCR.
REN Mao-Zhi et al.: Structural Characteristics and Genetic Expression of nodulin-like Gene and Its Promoter in Cotton 1427
unidentical regions showed where introns were localized.
Second, performed by BLASTX, DNA fragment was trans-
lated into six possible amino acid sequences, which shared
certain protein homology with nodulin-like protein in many
plants, with the highest up to 49% with N21 protein
(AAM65466) from Arabidopsis. Amino acid sequence of 4
to 60 in N21 protein shared 77% homology with product
translated from bases 2 099-2 269 in DNA sequence; se-
quence of 61 to 81 in N21 was about 68% amino acid iden-
tity with the one translated from bases 2 914-2 988 in DNA
fragment; amino acid sequence of 82 to 316 in N21 protein
shared 43% homology with amino acid sequence deduced
from bases 3 074-4 042 in DNA fragment. Based on the
analyses above, these corresponding DNA sequences were
regarded as potential exons, whereas those share no much
amino acid identity with N21 protein, were considered to be
introns. Third, using DNAStar, DNA sequence was trans-
lated into three possible amino acid sequences, among
which sequences of more than 40 amino acids were de-
duced from potential exons. Thus, putative exons in
nodulin-like gene were targeted on DNA sequence. Based
on the sequences of putative exons, primers (CF1, CF2,
CF3, CF4, CF5, CF6, CF7 and CR1, shown in Fig.2D and
Table 1) were designed for cDNA walking in 5 end. Those
Fig.2. Agarose gel elecrophoresis analysis of RT-PCR products and scheme on isolating full-length cDNA sequence of nodulin-like gene
and promoter sequence from cotton by rapid isolating cDNA 5 unknown sequence and promoter (RICUP). M, GeneRulerTM 1 kb DNA
Ladder Mix was used as a size marker. A. The first round of cDNA walking (for laneⅠ). B. The second round of cDNA walking (for lanes
Ⅱ, Ⅲ, Ⅳ and Ⅴ). C. The third round of cDNA walking (for lane Ⅵ). D. Scheme of the procedure.
Acta Botanica Sinica 植物学报 Vol.46 No.12 20041428
analyses were subjected to RT-PCR validation.
2.3 Isolation of full-length cDNA of nodulin-like gene in
cotton
The 862-bp product in 3 end of cDNA was generated
from CF1 and Oligo (dT18) primers (Table 1), with total RNA
from 7 to 10 dpa fiber of cotton as template (Fig.2A).
Therefore, transcription terminator was located at 4 506 bp.
Then, primers CF2, CF3, CF4, CF5 and CF6 were designed,
working with CR1 respectively, for nodulin-like gene cDNA
walking by RT-PCR with the same template. No specific
band was produced from the other three primer pairs, CF2/
CR1, CF5/CR1, CF6/CR1, while two products of 1 176 and
1 341 bp were amplified from CF3/CR1 and CF4/CR1 primer
pairs (Fig.2B), respectively, by which cDNA walking was
performed towards 5 terminus by 357 and 522 bp, respec-
tively (Fig.2D). Comparison with DNA sequence explained
the results. CF2 was designed in an intron, resulting in no
specific amplification of cDNA fragment; CF3 and CF4 were
designed in the same exon. So, specific cDNA fragments
were produced; CF5 and CF6 were probably designed ei-
ther in an intron or outside transcriptional initiation site, on
which further work is needed (Fig.2D).
Analysis of DNA sequence between CF4 and CF5 indi-
cated that several typical structures of promoter were found
in this region, such as TATA box and CAAT-like box
(Fig.2D). Furthermore, an initiator-like structure was found
around 1 969 bp. Those clues pointed to a hypothesis that
transcriptional initiation site was around 1 969 bp. To vali-
date this, RT-PCR amplification was performed with CF7
(designed around initiator-like region) and CR1 as primers
and a 1 432-bp fragment was amplified from fiber total RNA
(Fig.2C). Sequencing result suggested that it was extention
of the product amplified in the former round of PCR
amplification. It was extended towards 5 end by 95 bp.
Thus, initiator was located at 1 969 bp, meaning obtainment
of full-length cDNA in 5 end. Performed by DNAStar/
Fig.3. DNA, cDNA and promoter sequences of nodulin-like gene obtained by Ⅱ-PCR and rapid isolating cDNA 5 unknown sequence
and promoter (RICUP) from Gossypium hirsutum Guo Y18. Exons are shadowed. The untranslated regions of cDNA are in italic and non-
shadowed sequences represent introns or promoters.
REN Mao-Zhi et al.: Structural Characteristics and Genetic Expression of nodulin-like Gene and Its Promoter in Cotton 1429
Geneqest, sequence analysis revealed a 1 125-bp ORF
structure, encoding 375 amino acids. Using GenBank/
BLASTp, amino acid sequence was checked against pro-
tein database and it was found to share homology with nodulin
protein from several plants. Alignment with genomic DNA
demonstrated that complete nodulin-like gene was 2 353 bp,
including six exons and five introns (Fig.3D). The start codon
and stop codon were at 2 093 bp and 4 334 bp, respectively.
Full-length cDNA was 1 480 bp in size (Fig.3D).
2.4 Determination of transcription initiation site and
promoter of nodulin-like gene
Analysis of sequence upstream initiator indicated that
a typical TATA box was at –29 bp and a CCAAT-like box
was at –58 bp (Fig.2D). Further analysis of sequence down-
stream initiator suggested that start codon ATG was around
+124 bp. Considerable AT-riched sequences were distrib-
uted between ATG and initiator. Thus, transcription site of
nodulin-like gene was targeted at conserved A in initiator
structure. Its promoter was positioned between –1 969 bp
and +124 bp region. By ways of fragments deletion, further
work on functional analysis of the promoter has been car-
ried out to target elements that determine expressional
strength and speciality of the promoter.
2.5 Characteristic analysis, structural forecast of
nodulin-like protein and establishment of family tree
Amino acid sequence was deduced from nucleotide
sequence of nodulin-like gene. It has a compositional
bias for 375 amino acids, including 26 alkaline amino acids,
20 acidic amino acids, 169 hydrophobic amino acids and 93
polar amino acids. It is supposed to reach a molecular weight
of 40.23 kD. Its isoelectric point is 8.433. When pH is 7.0,
the protein is positively charged with electricity. Ten cys-
teines were found in this protein, participating in disulfide
bond formation, which may relate closely to functions of
nodulin-like gene. Analysis of hydrophobicility showed
that there were four big hydrophile groups (clustered mainly
at C terminus) and 10 hydrophobic groups (centered in the
middle part and at N terminus) in the protein (Fig.4A). Fur-
ther studies on its secondary structure indicated that most
of a-helixes were distributed at N and C terminus, and b-
pleated sheet and b-turn structures clustered in the middle
part (Fig.5B). Searched against protein database using
BLASTp/GenBank, nodulin-like gene was found to share
certain protein homology with several proteins from nodulin
family in Arabidopsis and rice, up to the highest 58% with
N21 from nodulin family in Arabidopsis thaliana and 49%
with MtN21 from nodulin family in rice (Fig.5). Alignments
between nodulin-like protein in cotton and other four pro-
teins from nodulin family in rice and Arabidopsis suggested
that they were highly conserved in three regions, amino
acids of 16-31, 91-157 and 285-337, which were probably
protein functional domains (Fig.5). To demonstrate their
Fig.4. Analysis of characteristics of nodulin-like protein and establishment of family tree. A. Analysis on hydrophobicility of nodulin-
like protein. B. Secondary structural forecast of nodulin-like protein. C. Establishment of family tree of nodulin proteins. At, Arabidopsis
thaliana; Gh, Gossypium hirsutum Guo Y18; Os, Oryza sativa.
Acta Botanica Sinica 植物学报 Vol.46 No.12 20041430
consanguineous relationship, performed by DNAStar, fam-
ily tree was established with those amino acids sequences
of proteins. Result showed that nodulin-like protein in cot-
ton shared higher homology with nodulin protein in
Arabidopsis than the one in rice, indicating that (1) amino
acid sequences in cotton and Arabidopsis were more con-
served in evolution than the one in rice, and (2) nodulin-
like protein in cotton had close distance in evolution with
nodulin protein in Arabidopsis while relatively far distance
with the one in rice (Fig.4C).
2.6 Copy number analysis of nodulin-like gene in cotton
Forty µg genomic DNA was extracted from cotton leaves.
Then, DNA was completely digested with restriction
enzymes, such as HindⅢ, EcoRⅠ, BglⅡ and BamHⅠ,
respectively. Products were performed by electrophoresis.
The following protocols were carried out according to
merchant’s instructions, such as DNA transfer and
hybridization. Probe labeled by digoxigenin was fragment
of nodulin-like gene specifically amplified from cotton ge-
nome with SPF1 and SPR1 as primers (Table 1). Only a band
was detected in each lane, which indicated that one copy
of nodulin-like gene had been inserted into cotton ge-
nome (Fig.6).
2.7 Expressional analysis of nodulin-like gene in cotton
Fifteen µg of total RNA (extracted from root, stem, leaf,
bud, flower, fiber and boll shell of cotton, respectively) was
analyzed by electrophoresis with 1.5% formamide-formal-
dehyde denatured agarose gel. Then, the following steps
were performed, such as RNA transfer, Northern hybridiza-
tion and detection procedures. Probe labeled by digoxigenin
was cDNA fragment of nodulin-like gene specifically am-
plified from total RNA of cotton with NPF1 and NPR1 as
primer pairs (Table 1). Results showed that nodulin-like
gene expressed predominantly in fiber and cotton re-
productive organs, including bud, flower and boll shell
(Fig. 7).
Fig.5. Alignment of nodulin-like protein in cotton and the other four members from nodulin protein family in rice and Arabidopsis.
Sequences were aligned and displayed using DNAStar program. Shadowed parts indicate conserved amino acid residues. The dot
indicates a gap that has been inserted for optimal alignment. N1, Gossypium hirsutum Guo Y18 nodulin-like; N2, Arabidopsis thaliana
MtN21; N3, A. thaliana N21; N4, Oryza sativa MtN2; N5, O. sativa Nod1.
REN Mao-Zhi et al.: Structural Characteristics and Genetic Expression of nodulin-like Gene and Its Promoter in Cotton 1431
3 Discussion
Great efforts have been made to obtain agronomic char-
acters of reproductive organs by cotton breeders, such as
male sterile, fertility restorer and qualities of fiber. In the
past decades, traditional breeding had made great contri-
bution in this field. However, due to some restriction factors,
such as long time needed in breeding, traditional breeding
techniques have made slow progresses in improvement of
those characters. However, with increasing development
being made in biotechnology, more and more genes of in-
terest have been identified, which express preferentially in
cotton reproductive organs. Furthermore, their character-
istics and functions have been studied. Undoubtedly, those
genes are wonderful candidates to improve property of
cotton reproductive organs. In this study, Northern blot
result showed that nodulin-like gene expressed mainly in
bud, flower and boll of cotton, which suggested that the
gene was involved in differentiation and development of
cotton reproductive organ and it was a reproductive or-
gan-preferential gene. Importantly, nodulin-like gene is
dramatically active at early stage of fiber formation and its
expressional level at late stage of fiber development is also
considerably high. These results demonstrated that this
fiber development-related gene played very important role
in differentiation and development of cotton fiber. Further
studies on functional character of nodulin-like protein and
its promoter have been carried out, and particulars on struc-
tural characters and genetic expression of nodulin-like gene
have also been performed. Promisingly, these results will
lay solid foundation for researches on relationship between
nodulin-like gene and property of cotton reproductive
organs, such as male sterile, fertility restorer and qualities
of fiber.
In addition, reports showed that cotton reproductive
organs were main targets of bollworms. For example, boll-
worms are fed mainly on reproductive organs of cotton
when plants bear buds, resulting in great losses in
productivities. Bt gene, driven by CAMV35S promoter, ex-
pressed highly in root, stem and leaf of cotton, but demon-
strated relatively low expression level in cotton reproduc-
tive organs. Thus, big problem has been generated, namely,
high insect resistance at early developmental stage of
cotton, but rather low resistance to bollworm at late stage
(Jia et al., 2001). Therefore, isolation of promoter, enhancer
or other expression and controlling elements in reproduc-
tive organ-specific gene, which determine predominant ex-
pression of corresponding genes in cotton reproductive
organs, will provide wonderful candidates in further re-
searches on Bt cotton. Sequencing result showed that typi-
cal sequences of promoter, such as initiator, TATA box and
CAAT-like box were detected in promoter region of nodulin-
like gene, resulting in strong promoting activity and tissue
specificity of the promoter (Weaver, 2002). Northern blot-
ting analysis confirmed the promoter could drive nodulin-
like gene expressing efficiently in reproductive organs.
Therefore, the promoter is considered to be useful expres-
sion element for deep researches on Bt cotton. Furthermore,
it can also be used in cotton breeding. For instance, many
virulent genes, driven by the promoter, can express effi-
ciently in flora organs, resulting in stunt of pollen, by which
male strile line of cotton can be created. Hopefully, the
work will lay foundation for research on cotton genetic
engerneering.
References:
Becker J D, Moreira L M, Kapp D, Frosch S C, Puhler A, Perlic
A M. 2001. The nodulin vfENOD18 is an ATP-binding
Fig.6. Southern blotting analysis of nodulin-like gene in cotton.
M, GeneRulerTM 1 kb DNA Ladder Mix was used as a size
marker. Forty µg genomic DNA of cotton was digested com-
pletely with the restriction enzymes, Hind Ⅲ (lane 1), EcoRⅠ
(lane 2), Bgl Ⅱ (lane 3) and BamHⅠ (lane 4), respectively (1 to
4) . Products were analyzed by electrophoresis with 0.8% agar-
ose gel.
Fig.7. Northern blotting analysis of nodulin-like gene in cotton.
Fifteen µg of total RNA extracted from root (lane 1), stem (lane
2), leave (lane 3), bud (lane 4), flower (lane 5), boll shell (lane 6),
early fiber (lane 7) and late fiber (lane 8), respectively was ana-
lyzed by 1.5% agarose gel electrophoresis denatured by formal-
dehyde (lower) and transferred to nylon membrane (upper). Sig-
nals were detected in lanes 4 to 8.
Acta Botanica Sinica 植物学报 Vol.46 No.12 20041432
protein in infected cells of Vicia faba L. nodules. Plant Mol
Biol, 47: 749-759.
Fruhling M, Schroder G, Hohnjec N, Puhler A, Perlick A M,
Kuster H. 2000. The promoter of the Vicia faba L. gene
VfEnod12 encoding an early nodulin is active in cortical cells
and nodule primordia of transgenic hairy roots of Vicia hirsuta
as well as in the prefixing zone Ⅱ of mature transgenic V.
hirsuta root nodules. Plant Sci, 160: 67-75.
Guo W Z, Sun J, Zhang T Z. 2003. Genes cloning and molecular
breeding to improve fiber qualities in cotton. Chin Sci Bull, 48:
410-417.
Hohnjec N, Kuster H, Albus U, Frosch S C, Becker J D, Puhler A,
Perlick A M, Fruhling M. 2000. The broad bean nodulin
VfENOD18 is a member of a novel family of plant proteins
with homologies to the bacterial MJ0577 superfamily. Mol
Gen Genet, 264: 241-250.
Hou L , Xiao Y-H , Li X-B, Wang W-F , Luo X-Y, Pei Y. 2002. The
cDNA-AFLP differential display in developing anthers between
male sterile and fertile line of “Dong A”. Acta Genet Sin , 29:
359-363. (in Chinese with English abstract)
Huang J, Ge X, Sun M. 2000. Modified CTAB protocol using a
silica matrix for isolation of plant genomic DNA.
BioTechniques, 28: 432- 434.
Ji S J, Lu Y C, Feng J X, Wei G, Li J, Shi Y H, Fu Q, Liu D, Luo
J C, Zhu Y X. 2003. Isolation and analyses of genes preferen-
tially expressed during early cotton fiber development by sub-
tractive PCR and cDNA array. Nucleic Acids Res, 31: 2534-
2543.
Jia S-R, Guo S-D, An D-C. 2001. The Transgenetic Cotton. Beijing:
Science Press. (in Chinese)
John M E, Petersen M W. 1994. Cotton (Gossypium hirsutum
L.) pollen-specific polygalacturonase mRNA: tissue and tem-
poral specificity of its promoter in transgenic tobacco. Plant
Mol Biol, 26: 1989-1993.
Laplaze L, Ribeiro A, Franche C, Duhoux E, Auguy F, Bogusz D,
Pawlowski K. 2000. Characterization of a Casuarina glauca
nodule-specific subtilisin-like protease gene, a homolog of
Alnus glutinosa ag12. Mol Plant Microbe In, 13: 113-117.
Liu H C, Creech R G, Jenkins J N, Ma D P. 2000. Cloning and
promoter analysis of the cotton lipid transfer protein gene
Ltp3(1). Biochim Biophys Acta, 1487: 106-111.
Luo K-M, Guo Y-L, Xiao Y-H , Hou L, Pei Y . 2002. Cloning and
characterization of D-113 gene promoter from cotton. Acta
Genet Sin, 29: 161-165. (in Chinese with English abstract)
Mathis R, Grosjean C, de Billy F, Huguet T, Gamas P. 1999. The
early nodulin gene MtN6 is a novel marker for events preced-
ing infection of Medicago truncatula roots by Sinorhizobium
meliloti. Mol Plant Microbe In, 12: 544-555.
Rhijn P, Fang Y, Galili S, Shaul O, Atzmon N, Wininger S, Eshed Y,
Lum M, Li Y, To V V, Fujishige N, Kapulnik Y, Hirsch A M.
1997. Expression of early nodulin genes in alfalfa mycorrhizae
indicates that signal transduction pathways used in forming
arbuscular mycorrhizae and Rhizobium-induced nodules may
be conserved. Proc Natl Acad Sci USA, 94: 5467-5472.
Rinehart J A, Petersen M W, John M E. 1996. Tissue-specific and
developmental regulation of cotton gene FbL2A. Demonstra-
tion of promoter activity in transgenic plants. Plant Physiol,
112: 1331-1341.
Sambrook J, Fritsch E F, Maniatis T. 1989. Molecular Cloning: a
Laboratory Manual. 2nd ed. New York: Cold Spring Harbor
Laboratory Press.
Sousa C, Johansson C, Charon C, Manyani H, Sautter C,
Kondorosi A, Crespi M T. 2001. Translational and structural
requirements of the early nodulin gene enod40, a short-open
reading frame-containing RNA, for elicitation of a cell-spe-
cific growth response in the alfalfa root cortex. Mol Cell Biol,
21: 354-366.
Staehelin C, Charon C, Boller T, Crespi M, Kondorosi A. 2001.
Medicago truncatula plants overexpressing the early nodulin
gene enod40 exhibit accelerated mycorrhizal colonization and
enhanced formation of arbuscules. Proc Natl Acad Sci USA,
98: 15366-15371.
Sunilkumar G, Connell J P, Smith C W, Reddy A S, Rathore K S.
2002. Cotton alpha-globulin promoter: isolation and func-
tional characterization in transgenic cotton, Arabidopsis, and
tobacco. Transgenic Res, 11: 347-359.
Suo J, Liang X, Pu L, Zhang Y, Xue Y. 2003. Identification of
GhMYB109 encoding a R2R3 MYB transcription factor that
expressed specifically in fiber initials and elongating fibers of
cotton (Gossypium hirsutum L.). Biochim Biophys Acta, 1630:
25-34.
Ulloa M, Meredith W R, Shappley Z W, Kahler A L. 2002. RFLP
genetic linkage maps from four F (2.3) populations and a
joinmap of Gossypium hirsutum L. Theor Appl Genet, 104:
200-208.
Wan C Y, Wilkins T A. 1994. A modified hot borate method
significantly enhances the yield of high-quality RNA from
cotton (Gossypium hirsutum L.). Anal Biochem, 223: 7-12.
Weaver R F. 2002. Molecular Biology. McGraw-Hill Companies,
Inc. 281-551.
Zhang T, Yuan Y, Yu J, Guo W, Kohel R J. 2003. Molecular
tagging of a major QTL for fiber strength in upland cotton and
its marker-assisted selection. Theor Appl Genet, 106: 262-
268.
Zhao G R, Liu J Y, Du X M. 2001. Molecular cloning and charac-
terization of cotton cDNAs expressed in developing fiber cells.
Biosci Biotechnol Biochem, 65: 2789-2793.
(Managing editor: ZHAO Li-Hui)