全 文 ：Received 19 May 2003 Accepted 15 Jul. 2003
Supported by the State Key Basic Research and Development Plan of China (G2000016205) and the National Natural Science Foundation of
China (39989001).
* Author for correspondence. E-mail: .
http://www.chineseplantscience.com
Virus-induced PVX Coat Protein Gene Silencing and Methylation
in Transgenic Tobaccos
FENG De-Jiang, LIU Xiang, SONG Gui-Sheng, XU Hong-Lin, WEI Xiao-Li, XU Jun-Wang, ZHU Zhen*
(Institute of Genetics and Developmental Biology, The Chinese Academy of Sciences, Beijing 100101, China)
Abstract: Transgenic tobacco (Nicotiana tabacum L. cv. Xanthi) plants which express coat protein (CP)
gene (cp) of potato virus X (PVX) were generated via Agrobacterium tumefaciens-mediated gene transfer.
Northern blotting analysis indicated that cp silencing happened in three transformants, and Run on assay
showed that the cp silencing was at post-transcriptional level. The result of cp methylation assay showed
different degree of methylation existed in coat protein gene coding sequences. cp methylation was also
analyzed during virus-induced gene silencing (VIGS), and results suggested that methylation pre-existed in
cp non-silenced transgenic plants, while virus infection increase the methylation degree, which indicated
DNA methylation in VIGS was not a de novo DNA methylation process.
Key words: potato virus X; coat protein; transgenic plant; DNA methylation; post-transcriptional gene
silencing
Great achievements on the mechanism of gene silencing
have been made since it was first reported in 1990 (Napoli et
al., 1990; Wassenegger, 2002). Gene silencing, also termed
gene inactivation, can be caused by many factors and be
sorted into a few classes (Kooter et al., 1999). Homology-
dependent gene silencing (HdGS) among these classes can
be divided into transcriptional gene silencing (TGS) and
post-transcriptional gene silencing (PTGS). In TGS, gene
silenced transcriptionally being homologous in promoter
regions and cytosine residues in promoter sequences are
methylated. Gene targeted for PTGS shares homology in
transcribed regions, and has no apparent effect on tran-
scription of the target gene (transcribe normally or even
highly) but promotes a rapid and specific turnover of RNA
transcripts in the cytoplasm. This type of gene silencing,
such as co-suppression (Napoli et al., 1990) and virus-in-
duced gene silencing (VIGS) (Ruiz et al., 1998), has been
studied extensively in plants (Dorer and Henikoff, 1994).
Methylation, another biological phenomenon, has an
important role in the regulation of gene expression in plant,
and can lead to aberrant expression of targeted gene (Li et
al., 1998). Kilby et al. (1992) found that the loss of kanamy-
cin resistance was associated with methylation of the nos
promoter of the nptⅡ resistance gene. Treatment of inac-
tive plant lines with the de-methylating agent 5-azacytidine
could restore kanamycin resistance (Zhu et al., 1991). Sub-
sequent experiments showed that the transcription of tar-
geted gene could be repressed for the methylation in
upstream promoter sequence and the gene silenced. These
experiments indicated that this phenomenon belongs to tran-
scriptional gene silencing (Zhu et al., 1991; Park et al., 1996;
Dieguez et al., 1998).
Co-suppression, a universal phenomenon in transgenic
engineering, was first discovered in 1990 (Napoli et al., 1990).
The expression of transgene as well as endogenous gene
was repressed in transgenic petunia (Napoli et al., 1990).
Additionally, transgene or endogenous gene in plant can
be silenced by infection of RNA viruses carrying sequences
homologous to the transgene or the endogenous gene (Sleat
et al., 1998; Dalmay et al., 2000; Burton et al., 2001). For
example, endogenous cellulose synthase genes (cesA) of
tobacco were silenced by infection of potato virus X carry-
ing a putative cesA cDNA fragments. Infected plants showed
short internode length, small leaves, dwarf phenotype and
abnormally large spherical cells ballooned from the
undersurfaces of leaves for the loss of cell wall cellulose
(Burton et al., 2001). Green fluorescent protein gene (gfp)
also could be silenced completely in transgenic Arabidopsis
inoculated with PVX:GFP (Dalmay et al., 2000). Studies indi-
cated that co-suppression, in fact, was a kind of PTGS caused
by the interaction between endogenous gene and foreign
gene (de Wilde et al., 2001). But other experiments showed
that high-expression of a single gene could also lead to PTGS
phenomenon (Fagard and Vaucheret, 2000), and went with
methylation in coding sequence of targeted gene (Voinnet,
2001). The similar phenomena of gene silencing were also
Acta Botanica Sinica
植 物 学 报 2004, 46 (1): 116-123
117FENG De-Jiang et al.: Virus-induced PVX Coat Protein Gene Silencing and Methylation in Transgenic Tobaccos
found in animals and fungi (Wassenegger et al., 1994).
The fact that transgene can be silenced and virus repli-
cation can be repressed in plant by DNA methylation or co-
suppression has important biological effect on the interac-
tion of plant and virus. Wassenegger et al. (1996) found
that the cDNA fragment of potato spindle tuber viroid
(PSTVd) could become fully methylated whereas the flank-
ing T-DNA and the genomic plant DNA remain unaltered,
and viroid cDNA methylation could only be observed after
autonomous viroid RNA-RNA replication had taken place
and replication of virus had been repressed in these plants
(Wassenegger et al., 1996). The expression of nuclear gene
in plant can also be inhibited by a sequence-specific RNA
degradation mechanism (termed RNA interference) when
RNA virus replicate in cytoplasm of plant (English et al.,
1996). Up to now, the relationship between DNA methyla-
tion and gene silencing still remains unclear. In this study,
the methylation states of potato virus X (PVX) coat protein
(CP) gene (cp) in transgenic plants were detected, and the
degree of cp methylation during VIGS was also analyzed.
1 Materials and Methods
1.1 Materials
Experimental materials used in this study were tobacco
(Nicotiana tabacum L. cv. Xanthi), Escherichia coli DH5a
and Agrobacterium tumefaciens LBA4404. Plasmids
pSPROK carrying cauliflower mosaic virus (CaMV) 35S pro-
moter and terminator of nopaline synthase gene and binary
vector pCNPTII2300 were constructed in the author’s
laboratory. Clone vector pBlueKS (+/-) was purchased from
Stratagene (USA). Virus vector pP2C2S was a kind gift from
Prof. D C BAULCOMBE of British John Inners Center, which
containing full-length sequence of potato virus X HB strain
(GenBank number: X72214). Restriction endonucleases and
modification enzymes were purchased from New England
Biolabs (USA). High fidelity Taq was bought from Sangon
(Canada). Random primer labeled kit and in vitro transcrip-
tion kit were purchased from Promega (USA). a-32P-dCTP
and a-32P-UTP were bought from Yahui (China).
1.2 Clone of potato virus X coat protein gene
PVX coat protein gene (cp) were gotten by polymerase
chain reaction (PCR) using pP2C2S as template, and P1 (5-
GCTCTAGAGATGTCAGCACCAGCTAGCA CAAC-3
containing XbaⅠ recognition sequence) and P2 (5-
GGGGTACCCTGGTGG TGGTAGAGTGAC-3 containing
KpnⅠ recognition sequences) were used as primers. PCR
products were digested with XbaⅠ and KpnⅠ, and were
gel-purified and inserted into pBlueKS (+/-). Then vector
pBCP was produced. The cp coding region in pBCP was
sequenced to ensure that no mutations were introduced
during PCR.
1.3 Construction of plant expression vector
cp gene from pBCP was excised with XbaⅠ and Kpn Ⅰ,
and was inserted into the same site of pSPROK to produce
pSPCPM. Expression structure of CaMV35S-cpm-Tnos from
pSPCPM digested with EcoRⅠ and HindⅢ was inserted
into corresponding sites of binary vector pCNPTII2300,
and plant expression vector pCP2300 was gotten.
1.4 Tobacco transformation and PCR analysis of
transgenic plants
The binary vector pCP2300 was transformed into A.
tumefaciens strain LBA4404 by electroporation according
to the instruction of Escherichia coli pulser apparatus
(Bio-Rad). Tobacco was transformed by the ameliorated
leaf disc transformation method via Agrobacterium-medi-
ated transformation procedure (Gao et al., 1998). Shoots
were rooted on medium containing 75 mg/L kanamycin, and
cultivated in water for 3 d, then transferred to soil and grown
in greenhouse. After about six weeks, the third leaf from
growing point was selected for the detection of Northern
blot and Run on assay, and the second leaf was inoculated
with PVX.
Genomic DNA was isolated from the leaves of transgenic
plants using the modified CTAB method (Gao et al., 1998).
PCR was conducted using 0.2 µg genomic DNA as tem-
plate and P1 and P2 as primers. PCR products were electro-
phoresed on 1% agarose gel, and the agarose was detected
and photographed.
1.5 In vitro transcription of virus vector and PVX inocu-
lation of transgenic tobacco
Virus vector pP2C2S was linearized with SpeⅠ, and pu-
rified with equal volume of phenol：chloroform, and pre-
cipitated with ethanol. In vitro transcription was done ac-
cording to the instruction of protocol. ATP, UTP, CTP (each
2 mmol/L), 0.2 mmol/L GTP, 0.5 mmol/L m7G(5)PPP(5)G cap,
RNase inhibitor (Pharmacia), 1 µg linear DNA (pP2C2S) and
T7RNA polymerase were added into transcription buffer.
The mixture was incubated at 37 ℃ for 30 min, and GTP was
added to final concentration of 2 mol/L, then incubated at
37 ℃ for 1 h. The reaction mixture was extracted by water-
saturated phenol：chloroform, and the RNA was precipi-
tated with ethanol.
In vitro transcripts dissolved in 50 mmol/L PBS buffer
were inoculated directly to young leaves of transgenic to-
bacco after abrading the leaf surface with carborundum
(600 grit) and gently rubbed on the leaf surface. The PVX-
inoculated transgenic plants were incubated at 25 ℃ with
light for 16 h, then 20 ℃ for 8 h, after that, kept at 25 ℃. The
Acta Botanica Sinica 植物学报 Vol.46 No.1 2004118
virus symptoms of transgenic tobacco were observed ev-
ery other 5 d.
1.6 Northern blot
Total RNA was extracted according to the method de-
scribed by Chomczynshi and Sacchi (1987). Fifteen µg total
RNA separated in 1.2% agarose gels containing 0.1% form-
aldehyde by electrophoresis was blotted to membrane
(Hybond-N+, Amersham) with 20× SSC overnight and
fixed to the membrane by baking for 2 h at 80 ℃ in vacuum
oven and was ready for Hybridization (Sambrook et al.,
1989). The membrane was probed with labeled cp, and 18S
rDNA respectively. The membrane was pre-hybridized in 0.
5 mol/L sodium phosphate buffer containing 7% SDS (W/
V) at 65 ℃ for 2 h. Probe of cp was random-primer labeled
with a-32P-dCTP. Hybridization was carried out at 65 ℃
overnight. Following hybridization the membrane was
washed three times in 1×SSC, 0.1% SDS at 65 ℃ for 10
min, and exposed to X-ray film (Fuji) at –70 ℃.
1.7 Run on assay
Transcriptional ratios of cp genes were conducted as
described (Kanazawa et al., 2000). Fresh leaf tissues were
put into a plastic petri dish (5 cm in diameter) and cut into
pieces by using a razor blade in 2 mL of extraction buffer on
ice (1.14 mol/L sucrose; 10 mmol/L Tris-HCl (pH 7.6); 5 mmol/L
MgCl2; 0.1 mmol/L 1,10-phenanthroline; 0.1 mmol/L
phenylmethylsulfonylfluoride (PMSF); 0.15% Triton X-100;
0.1% thiodiglycol). Then transfered the suspension into a
15 mL pre-chilled plastic tube through filter and squeeze it
out by using tweezers to remove cell debris. Gently transfer
the suspension onto 100 µL of sucrose cushion (2 mol/L
sucrose, 10 mmol/L Tris-HCl, pH 7.6; 5 mmol/L MgCl2) in a
1.5 mL microtube. Centrifuge the tube for 5 min at 1 800g,
discard the supernatant. Add 600 µL of extraction buffer
and re-suspend the pellet from the top of the sucrose
cushion. Centrifuge for 5 min at 1 000g and resuspend the
pellet in 100 µL of the transcription buffer. cp and nptⅡ
were labeled with a-32P-UTP, and hybridized with plasmids
on members with cpw and nptⅡ genes. Hybridization sig-
nals were quantified with a phosphorImager using
Imagequant software.
1.8 Southern blot
Ten mg of genomic DNAs were digested with methyla-
tion sensitive enzyme HaeⅢ (Jones et al., 1999), followed
by blotting and hybridization with the cp coding sequence
probe. In another experiment for DNA methylation assay,
genomic DNAs of plants before and after PVX inoculation
were digested with methylation-sensitive enzymes PstⅠ
(Marano et al., 1991) and XhoⅠ (Abrink et al., 1998), and
methylation non-sensitive enzymes EcoRⅠ and HindⅢ
with different enzyme combination. In the experiment of cp
copy number assay, genomes from transformants were di-
gested with EcoRⅠ and blotted onto membrane. Pre-hy-
bridization and hybridization were conducted as described
for Northern blotting analysis. All these digestions were
conducted with over-quantity enzyme for overnight to en-
sure that the genome DNAs were cut completely.
2 Results
2.1 Construction of plant expression vectors, tobacco
transformation and screening of regenerated plantlets
The sequence of cp coding region showed that there
was no mutation introduced, then the cp gene was inserted
into binary vector under the control of CaM35S promoter
(Fig.1 ) . Regenera ted shoo ts were go t ten via
Agrobacterium-mediated transformation. Genomic DNAs
were extracted from leaves of regenerated plantlets for PCR
analysis. PCR results of transgenic tobaccos showed that
an about 0.7 kb specific fragment, identical to the predicted
size, could be amplified from the DNAs of 48 regenerated
plants. But the band could not be amplified from the DNA
of plants transformed with pCNPTⅡ 2300. These results
showed that PVX cp gene had been introduced into the
genomes of tobacco.
Fig.1. Schematic map of transformant vector pCP2300. P-35S,
CaMV35S promoter; cp, PVX coat protein gene; P-nos, pro-
moter of nopaline synthase gene; nptⅡ, plant selective marker
neomycin phosphotransferase gene; T-nos, terminator of nopaline
synthase gene; LB, RB, left and right borders of T-DNA.
2.2 Transcript analysis
The PVX coat protein gene transcript was detected by
Northern blot of transgenic tobaccos. Results showed that
there were three in 48 transformants in which the specific
hybridization signals could not be detected. The result in-
dicated that cp gene was silenced in these transgenic to-
baccos (Fig.2a).
CP6 and CP10 were selected at random for PVX
inoculation. RNAs were isolated before virus inoculation,
and after 35 d post inoculation (dpi) for virus inducing cp
gene silencing. Northern blotting analysis showed that the
targeted hybridization signals could not be detected at 35
dpi, which suggested the cp was silenced after virus infec-
tion (Fig.2b).
2.3 Transcription ratio analysis of cp in transgenic tobaccos
Cell nuclei were extracted from leaves of transformant
119FENG De-Jiang et al.: Virus-induced PVX Coat Protein Gene Silencing and Methylation in Transgenic Tobaccos
CP27 carrying non-silenced cp gene and transformants CP7,
CP12, CP36 carrying silenced cp gene, and Run on was
performed. Results showed that specific hybridization
signals of cp and nptⅡ could be detected, and the signals
intensity of cp in cp silencing transformants were stronger
than that in cp non-silencing transgenic tobaccos (Fig.3a),
Fig.2. Northern blotting analysis of transgenic tobaccos. a. Northern blotting results of some transformants. 1-12, RNA samples
isolated from CP2, CP7, CP10, CP11, CP12, CP14, CP18, CP22, CP26, CP27, CP30 and CP36 transformants. The hybridization signal
could not be detected in samples of lanes 2, 5 and 12; 13, RNA sample from transformant transformed with pNPTⅡ2300 was as a
negative control. b. Transcription analysis of cp during virus-induced gene silencing (VIGS). RNAs were extracted from CP6 and CP10
before and after inoculation with PVX.
Fig.3. Run on assay of cp in transgenic tobaccos. a. Run on assay of some transformants containing silenced and non-silenced cp.CP27-
N, tranformant carrying non-silenced cp; CP7-S, CP12-S and CP36-S, transformants carrying silenced cp respectively. b. Run on asay of
CP10 during cp silencing. Nuclei were extracted from CP10 before and after cp gene silencing. Two mg pBCPW and 4 mg pCNPTII2300
were loaded on these membranes. CK, membrane only contained 4 mg pCNPTII2300. Hybridization signals were quantified with ImagTM
(Apha Co.) using IMAGEQUANT software.
Acta Botanica Sinica 植物学报 Vol.46 No.1 2004120
which indicated that cp gene was silenced at post-tran-
scriptional level, and showed “high transcriptional ratio in
nuclei, and low accumulation in cytoplasm”.
Transcription ratio of cp gene in transformant CP10 was
unchanged before and after virus infection (cp gene was
silenced), which suggested that cp silenced was at post-
transcriptional level during VIGS (Fig.3b).
2.4 Methylation assay of cp in transgenic tobaccos
There are three HaeⅢ recognition sites in cp coding
sequence at 90th bp, 544th bp and 605th bp, respectively,
and three partial fragments (0.454 kb, 0.515 kb and 0.061
kb) of cp gene can be cut out from binary vector pCP2300
(Fig.4a). Genomic DNAs were extracted from leaves of
transgenic tobaccos (CP7, CP12 and CP36 containing si-
lenced cp, and CP6, CP10 and CP22 with non-silenced cp)
and digested with HaeⅢ, then blotted onto membrane for
Southern blotting analysis. A band of 0.454 kb in cp-si-
lenced transformants (CP7, CP12 and CP36) was observed,
which indicated methylation happened at the HaeⅢ of
0.605 kb near 3-terminal of cp coding sequence. Another
band of 0.515 kb, besides the band of 0.454 kb, was also
found in transformants CP6, CP10 and CP22, which indi-
cated the HaeⅢ sites in cp DNA was not methylated. A
band of 0.061 kb should be detected in cp non-silenced
transformants, but could not be found on the membrane
maybe because the loading quantity of DNA samples is
not enough, which does not affect the methylation analy-
sis (Fig.4b).
The size of fragment is 1.4 kb between HindⅢ and
Xho Ⅰ, and 0.92 kb between EcoRⅠ and PstⅠ in the con-
struct of plant expression vector (Fig.4c). To gain further
insight into methylation during VIGS of cp coding region,
DNA samples from CP6 and CP10 were digested completely
by HindⅢ /XhoⅠ and EcoRⅠ /PstⅠ respectively before
and after PVX inoculation. Results of Southern blot showed
that the 1.4 kb and 0.92 kb fragments were detected in CP6
and CP10 respectively before inoculation, but could not be
detected after cp gene was silenced at 35 dpi (Fig.4b). At
the same time, the intensity of hybridization signals of 3.8
kb, 4.7 kb and 12 kb in CP6 DNA sample at 35 dpi was
stronger than that of signals before inoculation, which in-
dicated these three bands existed for cp DNA methylation
Fig.4. Methylation analysis of cp gene in transgenic tobaccos. a. Schematic map of HaeⅢ recognition sites in cp coding sequence. b.
Methylation sensitivity assay of HaeⅢ in cp. 1-3, DNA samples extracted from CP7, CP12 and CP36 carrying silenced cp gene; 4-6,
DNAs extracted from CP6, CP10 and CP22 carrying non-silenced cp gene. All these DNAs were digested completely with HaeⅢ. c.
Some endonuclease recognition sites in expression construct of pCP2300 vector. d. Methylation assay of cp in CP6 and CP10 transformants
during cp silencing. CP6 and CP10, DNAs extracted from CP6 and CP10 before and after virus inoculation and digested completely with
Hind Ⅲ/XhoⅠ and Pst Ⅰ/EcoRⅠ. e. Hybridization signals in CP6 in d were quantified with ImagTM (Apha Co.) using IMAGEQUANT
software.
121FENG De-Jiang et al.: Virus-induced PVX Coat Protein Gene Silencing and Methylation in Transgenic Tobaccos
(Fig.4e). Additional strong signal of about 4.3 kb fragment
was detected in CP10 after cp was silenced (Fig.4d). These
above results imply that the methylation state of cp coding
region is aggravated during VIGS.
2.5 Copy number analysis of cp in transgenic tobaccos
Southern blotting analysis of EcoRⅠ -digested DNA
samples from CP7, CP12, CP6 and CP10 transformants
showed that multi-copy number existed in these transgenic
tobaccos. cp-silenced CP7 and CP12 plants existed as 3-5
copies of cp gene at least, whereas in CP6 and CP10 plants
there existed few cp copy numbers (about two copies)
(Fig.5). The results indicated that there were high copy
numbers of cp in cp silencing transformants.
Previous studies implicated that DNA methylation was,
in general, taken place in promoter region in gene silencing
transformants, and repressed the transcription of targeted
gene (Park et al., 1996; Li et al., 1998). Other experiments
showed that post-transcriptional gene silencing was also
associated with DNA methylation (Ingelbrecht et al., 1994).
In this study, DNA methylation assay of three transformants
carrying silencing cp gene demonstrated that partial cod-
ing region of cp was methylated, especially near the 3-
terminal of cp gene. English et al. (1996) found that DNA
methylation only took place at the 3-terminal of gus in
transgenic plants. Other experiment got the same result
(Brault et al., 2002). These results demonstrated that me-
thylation degree is different in different regions of targeted
gene (Martin et al., 1996; van Houdt et al., 2000).
Wassenegger et al. (1994) thought that the double strand
RNA or single RNA produced in PTGS was interacted with
coding sequence of targeted gene, and leaded to de novo
methylation. The methylation in PTGS is also termed RNA-
mediated de novo methylation for RNA involved in the
methylation process of targeted gene (Wassenegger et al.,
1994). But how the RNA acts in the process of methylation
needs to be further studied.
The result of inoculation of CP6 and CP10 with PVX
indicated that cp was silenced in transformants at 35 dpi,
and silencing occurred at post-transcriptional level, which
suggested that VIGS is a type of PTGS (Voinnet et al., 1999;
Brault et al., 2002). The results of DNA methylation during
VIGS demonstrated that heavy methylation state exists in
cp coding sequence after cp silencing. Errors resulted from
position effect and copy number on the methylation assay
can be avoided by analysis of methylation of foreign gene
before and after virus-induced gene silencing in the same
transformant. Our results showed that cp transgene could
be silenced by inoculation of transgenic tobacco with PVX,
and was associated with methylation. How could methyla-
tion be initiated following infection by a cytoplasmically
replicating virus? Jones et al. (1998) thought that cytoplas-
mic RNA viruses communicating with the nucleus is re-
sponsible for inducing de novo methylation of homolo-
gous transgene sequences. But the specific mechanism
remains unclear. Comparing the intensity of hybridization
signals before inoculation with that after inoculation in CP6
(Fig.4d,e), we think that methylation state has existed in cp
coding sequence before infection, and the methylation was
only aggravated after virus inoculation, which is different
from the results of Jones et al. (1998). We suppose that
RNA virus may interact with some factors of methylation
process that have existed, and aggravated the methylation
Fig.5. Copy number assay of cp gene in transgenic tobaccos. 1-
2, CP6 and CP10 containing non-silencing cp gene; 3-4, CP7 and
CP12 containing silencing cp gene.
3 Discussion
Gene silencing is being studied extensively since it has
been discovered, and the same phenomenon was also found
in animals and fungi, including worms, insects and mammals,
etc., which revealed that gene silencing seems to occur in
all higher organisms and it can act at the transcriptional
and post-transcriptional level of gene expression (Sanders
et al., 2002). In this study, we obtained transgenic tobac-
cos carrying PVX coat protein gene via Agrobacterium
tumefaciens-mediated leaf disk transformation. Northern
blotting analysis showed that cp gene was silenced in CP7,
CP12 and CP36, and nuclear Run on assay confirmed that
cp gene was silenced at post-transcriptional level with high
transcription ratio in nuclei and low accumulation in cyto-
plasm (Hamada and Spanu, 1998).
Acta Botanica Sinica 植物学报 Vol.46 No.1 2004122
degree, rather than induce the de novo methylation
mechanism.
We found that there are more copy numbers of cp in
silencing transformants than that in non-silencing
transgenic tobaccos. Previous experiments demonstrated
that foreign genes could interact with each other, and sup-
press transcription of targeted gene when many foreign
genes exists in the same genome (Dorer and Henikoff, 1994;
Matzke et al., 1994). In this study, the cp transcription ra-
tios in silenced transformants were normal or even high
compared with that of non-silenced cp, which indicated the
transcription ratio of silenced cp was not affected because
of the high copy number of cp gene. The gene dosage may
have a main role in silencing of cp gene, which leads to
RNA turnover and increased sequence-specific degrada-
tion of transcripts (Palauqui and Vaucheret, 1995; Vaucheret
et al., 1998).
In recent years, great achievements have been gained
in the study of VIGS, and the relationship between DNA
methylation and gene silencing has been explained from
different aspects. Our results demonstrated that transgene
could be silenced by inoculation of virus carrying a se-
quence homologous to the transgene, and was associated
with aggravation of methylation in targeted gene coding
sequence, rather than induce the de novo methylation. But
how the RNA viruses interact with the factors of methyla-
tion process in nuclear gene needs further study, and an-
other new mechanism of gene regulation may be discovered.
References:
Abrink M, Larsson E, Hellman L. 1998. De-methylation of ERV3,
an endogenous retrovirus regulating the Kruppel-related zinc
finger gene H-plk, in several human cell lines arrested during
early monocyte development. DNA Cell Biol, 17:27-37.
Brault V, Pfeffer S, Erdinger M, Mutterer J, Ziegler-Graff V.
2002. Virus-induced gene silencing in transgenic plants ex-
pressing the minor capsid protein of Beet western yellows
virus. Mol Plant Microbe In, 15:799-807.
Burton R A, Gibeaut D M, Bacic A, Findlay K, Roberts K,
Hamilton A, Baulcombe D C, Fincher G B. 2001. Virus in-
duced silencing of a plant cellulose synthase gene. Plant Cell,
12:691-706.
Chomczynshi P, Sacchi N. 1987. A Single-step method of RNA
isolation by acid guanidinium thiocyanate phenol chloroform
extraction. Anal Biochem, 162:156-159.
Dalmay T, Hamilton A, Mueller E, Baulcombe D C. 2000. Potato
virus X amplicons in Arabidopsis mediate genetic and epige-
netic gene silencing. Plant Cell, 12:369-379.
de Wilde C, Podevin N, Windels P. 2001. Silencing of antibody
genes in plants with single-copy transgene inserts as a result
of gene dosage effects. Mol Gen Genet, 265:647-453.
Dieguez M J, Vaucheret H, Paszkowski J, Mittelsten Scheid O.
1998. Cytosine methylation at CG and CNG sites is not a
prerequisite for the initiation of transcriptional gene silencing
in plants, but it is required for its maintenance. Mol Gen Genet,
259:207-215.
Dorer D R, Henikoff S. 1994. Expansions of transgene repeats
cause heterochromatin formation and gene silencing in
Drosophila. Cell, 77:993-1002.
English J J, Mueller E, Baulcombe D C. 1996. Suppression of
virus accumulation in transgenic plants exhibiting silencing of
nuclear genes. Plant Cell, 8:179-188.
Fagard M, Vaucheret H. 2000. Systemic silencing signal (s). Plant
Mol Biol, 43:285-293.
Gao Y-F, Zhu Z, Xiao G-F, Zhu Y, Wu Qian , Li X-H . 1998.
Isolation of soybean kunitz trypsin inhibitor gene and its
application in plant insect-resistant genetic engineering. Acta
Bot Sin, 40:405-411. (in Chinese with English abstract)
Hamada W, Spanu P D. 1998. Co-suppression of the hydrophobin
gene HCf-1 is correlated with antisense RNA biosynthesis in
Cladosporium fulvum. Mol Gen Genet, 259:630-638.
Ingelbrecht I, van Houdt H, van Montagu M. 1994. Posttran-
scriptional silencing of reporter transgenes in tobacco corre-
lates with DNA methylation. Proc Natl Acad Sci USA, 91:
10502-10506.
Jones P L, Thomas C L, Maule A J. 1998. de novo methylation
and co-suppression induced by a cytoplasmically replicating
plant RNA virus. EMBO J, 17:6385-6393.
Jones L, Hamilton A J, Voinnet O, Thomas C L, Maule A J,
Baulcombe D C. 1999. RNA-DNA interactions and DNA
methylation in post-transcriptional gene silencing. Plant Cell,
11:2291-2301.
Kanazawa A, O’Dell M, Roger P, Hitchin E, Metzlaff M. 2000.
Mini-scale method for nuclear run-on transcription assay in
plant. Plant Mol Biol Rep, 18:377-383.
Kilby N J, Leyser H M, Furner I J. 1992. Promoter methylation
and progressive transgene inactivation in Arabidopsis. Plant
Mol Biol, 20:103-112.
Kooter J M, Matzke M A, Meyer P. 1999. Listening to the silent
genes: transgene silencing, gene regulation and pathogen
control. Trends Plant Sci, 4:340-347.
Li X-G , Xie Y-Q , Zhu Z . 1998. Advances on gene silencing in
transgenic plants, Biotech Inform , 3:1-8. (in Chinese with
English abstract)
Marano M R, Carrillo N. 1991. Chromoplast formation during
tomato fruit ripening. No evidence for plastid DNA
methylation. Plant Mol Biol, 16:11-19.
Martin T J, Sun L Y, Burtin D, Vernoy R, Rossin N, Tepfer D.
1996. Attenuation of the phenotype caused by the
root-inducing, left-hand, transferred DNA and its rolA gene
123FENG De-Jiang et al.: Virus-induced PVX Coat Protein Gene Silencing and Methylation in Transgenic Tobaccos
(correlations with changes in polyamine metabolism and DNA
methylation). Plant Physiol, 111:259-267.
Matzke A J, Neuhuber F, Park Y D, Ambros P F, Matzke M A.
1994. Homology-dependent gene silencing in transgenic plants:
epistatic silencing loci contain multiple copies of methylated
transgenes. Mol Gen Genet, 244:219-229.
Napoli C, Lemieux C, Jorgensen R. 1990. Introduction of a chi-
meric chalcone synthase gene into petunia results in reversible
co-suppression of homologous gene in trans. Plant Cell, 2:
279-289.
Palauqui J C, Vaucheret H. 1995. Field trial analysis of nitrate
reductase co-suppression: a comparative study of 38 combi-
nations of transgene loci. Plant Mol Biol, 29:149-159.
Park Y D, Papp I, Moscone E A, Iglesias V A, Vaucheret H,
Matzke A J, Matzke M A. 1996. Gene silencing mediated by
promoter homology occurs at the level of transcription and
results in meiotically heritable alterations in methylation and
gene activity, Plant J, 9:183-194.
Ruiz M T, Voinnet O, Baulcombe D C. 1998. Initiation and main-
tenance of virus-induced gene silencing, Plant Cell, 10:937-
946.
Sambrook J, Fritsch E F, Maniatis T. 1989. Molecular Cloning: a
Laboratory Manual. 2nd ed. New York: Cold Spring Harbor
Laboratory Press.
Sanders M, Maddelein W, Depicker A, van Montagu M,
Cornelissen M, Jacobs J. 2002. An active role for endogenous
beta-1,3-glucanase genes in transgene-mediated co-suppres-
sion in tobacco. EMBO J, 21:5824-5832.
Sleat D E, Plaskitt K A, Wilson T M. 1998. Selective encapsidation
(Managing editor: ZHAO Li-Hui)
of CAT gene transcripts in TMV-infected transgenic tobacco
inhibits CAT synthesis. Virology, 165:609-612.
van Houdt H, Kovarik A, van Montagu M. 2000. Cross-talk
between post transcript ionally silenced neomycin
phosphotransferase Ⅱ transgenes. FEBS Lett, 467:41-46.
Vaucheret H, Beclin C, Elmayan T, Feuerbach F, Godon C, Morel
J B, Mourrain P, Palauqui J C, Vernhettes S. 1998. Transgene-
induced gene silencing in plants. Plant J, 16:651-659.
Voinnet O, Pinto Y M, Baulcombe D C. 1999. Suppression of
gene silencing: a general strategy used by diverse DNA and
RNA viruses of plants. Proc Natl Acad Sci USA, 96:14147-
14152.
Voinnet O. 2001. RNA silencing as a plant immune system against
viruses. Trends Genet, 417:449-459.
Wassenegger M, Heimes S, Riedel L, Sanger H L. 1994. RNA-
directed de novo methylation of genomic sequences in plants.
Cell, 76:567-576.
Wassenegger M, Spieker R L, Thalmeir S, Gast F U, Riedel L,
Sanger H L. 1996. A single nucleotide substitution converts
potato spindle tuber viroid (PSTVd) from a noninfectious to
an infectious RNA for Nicotiana tabacum. Virology, 226:191-
197.
Wassenegger M. 2002. Gene silencing. Int Rev Cytol, 219:61-
113.
Zhu Z, Hughes K W, Huang L. 1991. Effects of 5 azacytidine on
transformation and gene expression in Nicotiana tabacum. In
Vitro Cell Dev Biol, 27:77-83.