全 文 ：Received 6 Jan. 2004 Accepted 28 Jun. 2004
Supported by the National Natural Science Foundation of China (30370759).
* Author for correspondence. Tel: +86 (0)571 86971414; Fax: +86 (0)571 86971501; E-mail: .
http://www.chineseplantscience.com
Acta Botanica Sinica
植 物 学 报 2004, 46 (11): 1347-1356
Isolation and Expression of a Wheat Pollen-Specific Gene
with Long Leader Sequence
JIN Yong-Feng*, BIAN Teng-Fei
(Institute of Biochemistry, Zhejiang University, Hangzhou 310029, China)
Abstract: Here we report the isolation and expression of a pollen-specific cDNA TaPSG719 with an
unusually long 5 leader sequence via suppression subtractive hybridization and 5/3 RACE techniques.
The insert in the TaPSG719 is 1 172-bp long, and encodes a protein of 188 amino acids long with a pI of
12.1. This sequence did not show a significant homology to any genes deposited in the public database by
BLAST search. Southern blot indicated that TaPSG719 might be multicopy. Northern blot and RT-PCR
analyses indicated that TaPSG719 transcripts were specific for mature pollen, and undetectable in microspore,
immature seed, stem, young leaf, root and ovary. During pollen development, TaPSG719 transcripts were
first detectable on the 5th day before anthesis and increased rapidly at middle stages of pollen development
with maximum levels on the 4th day before anthesis, and decreased during pollen maturation. It is noted
that TaPSG719 contains an unusually long 5 leader sequence (329-nt) upstream the ATG start codon,
suggesting that the gene could be subject to translational regulation. To investigate the role of the 5 UTR
on translation, in vitro transcription/translation assays with various deletion and mutation constructs
were performed using wheat germ extract. The results demonstrated that the 5 UTR affected positively
downstream translation in wheat germ extract.
Key words: wheat (Triticum aestivum); pollen-specific cDNA; gene expression; suppression
subtractive hybridization
Sexual reproduction requires the formation of male and
female gametophytes in angiosperm plants, which produce
male and female gametes (Dickinson, 1994). The formation
of pollen, as the male gametophyte, requires the co-ordinated
gene expression of the male gametophytes and the
sporophytic tissues surrounding them. It has been estimated
that 10% of the 20 000 different genes expressed in pollen
grains at anthesis are pollen-specific (Mascarenhas, 1993;
McCormick, 1993; Taylor and Hepler, 1997). Genes
expressed in anthers for male gametogenesis can be divided
into two groups (so-called early and late genes) based on
their expression timing for convenience. The early genes
become active soon after the completion of meiosis and the
levels of their transcripts are reduced or undetectable in
mature pollen (Mascarenhas, 1993). Early genes are either
expressed in both the sporophyte (e.g. tapetum) and the
gametophyte (microspore and/or young pollen) (Roberts
et al., 1993), or only in the tapetum (Charbonnel-Campaa
et al., 2000; Kapoor et al., 2002; Wang et al., 2002), in the
microspore and/or young pollen only (Roberts et al.,1993).
Tobacco NTM19 gene (Oldenhof et al., 1996) and the
Brassica napus BP4 and BP19 (Albani et al., 1990; 1991) ,
BnM3.4 gene (Fourgoux-Nicol et al.,1999), which fall into
this early gene category, have been isolated. The late genes
start to express after microspore mitosis and the expression
increases until maturity. These late genes have been
isolated from a number of plant species including
Arabidopsis (Gupta et al., 2002), tobacco (Tebbutt et al.,
1994; Brander and Kuhlemeier, 1995; Steiner et al., 2003),
maize (Estruch et al., 2003), tomato (Muschietti et al., 1994),
Chinese cabbage (Park et al., 2002), sunflower (Baltz et al.,
1992). Most of these gene products are accumulated
abundantly in pollen grains and involved in pollen
maturation or germination (Mascarenhas, 1993).
Much of our information on the molecular biology of
male gametophyte development is from the studies on a
few model and crop plants such as Arabidopsis, tobacco,
vegetable crops, and maize (Baltz et al., 1992; Muschietti
et al., 1994; Tebbutt et al., 1994; Brander and Kuhlemeier,
1995; Gupta et al., 2002; Park et al., 2002; Steiner et al.,
2003; Estruch et al., 2003). Wheat is one of the most
important cereal crops in the world, however, the molecular
biology of wheat male gametophyte development remains
poorly understood. No F1-hybrid seed technology is
commercially available in wheat despite many efforts. The
study of wheat anther and pollen development is immensely
important not only because of the understanding of gene
regulation in the sexual reproduction of wheat, but also of
Acta Botanica Sinica 植物学报 Vol.46 No.11 20041348
its potential application in agriculture such as male-sterility.
In this paper, we describe the isolation and expression
of a novel pollen-specific gene TaPSG719 from wheat via
suppression subtractive hybridization and 5/3 RACE
techniques. TaPSG719 transcripts reached the maximum
expression level at middle-late stages of pollen development
and decreased during pollen maturation. TaPSG719 had
no significant sequence similarity to protein deposited in
the public database. TaPSG719 had the unusually long 5
leader sequence upstream the putative open reading frame.
Most eukaryotic uORFs are neutral or repressive for the
translation of the downstream ORF in vitro transcription/
translation assays using wheat germ extract or rabbit
reticulocyte lysate (Geballe and Sachs, 1993). However, the
conditions in the wheat germ extract or rabbit reticulocyte
lysate in vitro translation assays may not be appropriate
for translational control by the uORFs from other species
to operate (Martinez-Garcia et al., 1998). In vitro translation
assays in the wheat germ extract for translational control
by wheat uORFs should be more appropriate for research
on translational control by the uORFs.
1 Materials and Methods
1.1 Plant materials
Seeds of the Austrian winter wheat cultivar Ferdinand
(Triticum aestivum L.) were sown in pots with soil and
germinated for one month in a growth chamber at 15 ℃
during the day and 12 ℃ at night, with a day length of 16 h,
60% humidity and a light intensity of 800 ME. Germinated
seedlings were vernalized at 4 ℃ for two months (10 h light,
80% humidity, 800 ME). Finally, the vernalized plantlets
were transferred to a climate chamber where they were
grown until tillering under the same conditions mentioned
above for seed germination.
1.2 Isolation of wheat male gametophyte at different
stages
Freshly cut wheat tillers and spikes at various stages of
pollen development were surface-sterilized with an aerosol
of 70% ethanol. Microspores and pollen grains at different
developmental stages were isolated from anthers excised
from spikes, by stirring the anthers in medium B with a
magnetic stirrer for 2-3 min at 750 r/min. Stages of pollen
development were determined as described earlier (Indrianto
et al., 2001). After three washes in medium B by centrifuga-
tion for 5 min at 100g, the pellet containing microspores
and pollen grains at different developmental stages were
frozen in liquid nitrogen for further use.
1.3 RNA and DNA isolation
Total RNA was isolated from wheat tissues using
RNeasy plant mini kit (Qiagen, Germany) according to the
manufacturer’s protocol. Genomic DNA for Southern blot
and PCR was isolated as described (http://www.protocol-
online.org/prot/Molecular_Biology/DNA/DNA_Extraction
_Purification).
1.4 Suppression subtractive hybridization
Suppression subtractive hybridization (SSH)
(Diatchenko et al., 1996) was done using the PCR-select
cDNA subtraction kit (Clontech, USA). Subtracted cDNAs
were cloned into the T/A vector pCR2.1 (Invitrogen, USA).
Clones carrying inserts were identified by the colony PCR.
The PCR mixture consisted of 0.2 mmol/L of M13 reverse
and forward primers each, 0.2 mmol/L of each dNTP, 2 mmol/L
MgCl2 and 1 U of Taq DNA polymerase (MBI Fermentas) in
an appropriate buffer. PCR parameters were: 94 ℃ for 2
min, 30 cycles of 94 ℃ for 1 min, 50 ℃ for 1 min, 72 ℃ for
2 min 30 s and final extension at 72 ℃ for 5 min. Differential
screening was carried out by reverse Northern hybridiza-
tion (RNH). DNA fragments obtained by colony PCR were
dotted onto membranes. Probes were synthesized with the
use of random primed DNA labeling kit (Invitrogen, USA).
Comparative RNH was performed with two or more identi-
cal replicas under stringent conditions (0.5 mol/L Na2HPO4
(pH 7.2), 7% SDS with 100 µg/mL denatured salmon sperm
DNA at 65 ℃ overnight) with equivalent amount of labeled
cDNA probes of nearly equal specific activity for each
experiment. Membranes were washed twice at 65 ℃ in 0.1
× SSC for 20-30 min.
1.5 Isolation of full-length cDNA
Full-length cDNA was obtained using SMART
technology (Clontech, USA). First strand cDNA was
synthesized from 0.5 µg total RNA isolated from mature
pollen using Superscript Ⅱ reverse transcriptase according
to the manufacturer’s instructions (Invitrogen, USA).
Specific primers were designed according to cDNA
sequence isolated by SSH. The 5 RACE primers were 5-
GGCTATGTAGGGGCAGTCCATGTCGCAG-3 and 5-
GTCCGCGCCGCATTGGGCAGA-3, and 3 RACE primer
was 5-TGTGGCACGGGCGAGAAGAAGGACGCC-3. PCR
products were purified using PCR purification kit (Qiagen,
Germany) and cloned into pCR2.1 vector (Invitrogen).
Isolation of recombinant clones was carried out using
standard procedures.
1.6 DNA sequence analysis
Sequencing of selected clones was done using ALF
semiautomatic DNA sequencer. Homology search for
sequences of selected clones was performed using basic
local alignment sequence tool (BLAST) at http://www.ncbi.
nlm.nih.gov/blast/blast.cgi and http://www.ebi.ac.uk/
JIN Yong-Feng et al.: Isolation and Expression of a Wheat Pollen-Specific Gene with Long Leader Sequence 1349
cgi-bin/clustalw/clustalw.pl.
1.7 Analysis of gene expression by RT-PCR
The single-stranded cDNA was synthesized from total
RNA and treated with DNase at 37 ℃ for 30 min. PCR
amplification was carried out using cDNA from 10 ng or 1
ng of total RNA template each reaction. Primer sets used
for the RT-PCR analysis of wheat cDNA clones are shown
in Table 1. Amplification conditions were 35 cycles of 94 ℃
for 30 s, 65 ℃ for 30 s and 72 ℃ for 30 s followed by one
cycle of 72 ℃ for 10 min. Control reactions were used to
test for contamination by genomic DNA. Wheat
glyceraldehyde-3-phosphate dehydrogenase (GAPDH)
gene transcripts were amplified as an internal control. PCR
products were separated on 2% agarose gels with ethidium
bromide.
1.8 Northern hybridization
Fifteen micrograms total RNA of each sample from dif-
ferent tissues was subjected to electrophoresis on 1.2%
(W/V) agarose/10% (V/V) formaldehyde denaturing gels,
and transferred to Hybond-N+ membrane (Pharmacia
Biotech) and UV cross-linked. Gene-specific fragments of
about 600 bp were generated from the specific regions of
the genes using PCR and labeled using random primed DNA
labeling kit. High SDS buffer and hybridization conditions
mentioned in SSH were used.
1.9 Southern hybridization
Five micrograms of genomic DNA was digested with a
variety of restriction endonucleases under the conditions
recommended by the enzyme supplier. Fragments were
resolved on 0.8% agarose gels and transferred to a Hybond-
N+ membrane. DNA gel blots were hybridized and washed
using the some condition as employed for RNA gel-blot
analysis.
1.10 In vitro transcription/translation
Three constructs were made using pHelix 1(-) (Roche
Biochemicals), of which the different 5 leader and coding
regions of TaPSG719 were cloned into BamHⅠ and PstⅠ
sites downstream of the T7 promoter. In the expression
plasmid with the long or truncated 5 leader sequence, a
unique site BamHⅠ was introduced by PCR. The primers
used were: primer 1: 5-GGGGATCCGCGGGGTCTCATCCA-
AGAG-3 , primer 2: 5-GGGGATCCTTGGCCGGTCATATC-
ATATAGAATTGCATG-3, primer 3: 5-GGGGATCCATGCA-
AAAAATTTGGCATG-3, primer 4: 5-ATGCATGCTCGAG-
CGGCCGCCA-3. The amplified product using primer 1 and
primer 4 was digested with BamHⅠ and PstⅠ and cloned
into pHelix1(-). The resulting construct contained the ma-
jor with long leader sequence of 329 nucleotides and was
designated pHelix719-1. pHelix719-2 with a truncated leader
sequence of 27 nucleotides was generated by point muta-
tion of the TaPSG719 uORF start codon (ATG→TTG) by
PCR using primer 2 and primer 4. pHelix719-3 construct was
made by deletion of the whole 5 leader sequence and gen-
erated by PCR using primer 3 and primer 4. The nucleotide
sequence of the subcloned fragment was checked. The re-
actions were performed with 0.2 µg of each linearized plas-
mid DNA using T7 RNA polymerase and wheat germ ex-
tract at a total volume of 25 µL (TnT wheat germ extract
system, Promega, USA) according to the manufacturer’s
protocol. It was confirmed that the three constructs tran-
scribed equally in transcription/translation reaction in vitro
with an identical amount of plasmid DNA. The resulting
[35S] methionine translation products were electrophoreti-
cally fractionated with 10% SDS-PAGE. The gel was fixed
Table 1 Primer sets used for the RT-PCR analysis of wheat cDNA clones
cDNA clone Primer Sequence (5→ 3) Predicted product size (~ bp)
WSM 076 Forward AGAGTCGGGGAGCCGGCAGCGGA 230
Reverse GACTGCTCGAGCTAATGTTGCCGGT
WSM 130 Forward GTACGCTGGCATGCACGACACT 100
Reverse GCACTGAACTTACAATGAGATTAGCATGGG
WSM 158 Forward CTGCACCGACGTTATGCCATTTCAT 100
Reverse CAGCGGACGACAGAGCGGAAGGCCA
WSM 359 Forward CAAACACGATCGACACGGTCGATATG 450
Reverse GGGCGCGTACTTGCAGCGCACCCTCCT
WSM 626 Forward ACACCAGTGCTTGTTATTATGCATG 140
Reverse AGATATATAGATAGATCTCCGTTAC
WSM 719 Forward GTACCGGCAACAAGACGGTCTATCT 170
Reverse CTTGGTCGATGGCTTTCTTATTGGC
WSM 802 Forward ACGAGGGAAGTGCAGCGTGACAACCTGT 150
Reverse TACAGCAGGGGCTGGCACTCTTGCCGTGC
GAPDH Forward CAACGCTAGCTGCACCACTAACT 350
Reverse GACTCCTCCTTGATAGCAGCCTT
Acta Botanica Sinica 植物学报 Vol.46 No.11 20041350
in fixing solution (50% methanol, 10% glacial acetic acid)
for 30 min and then incubated in the solution (7% acetic
acid, 7% methanol and 1% glycerol) for 5 min and dried
completely at 80 ℃ under a vacuum and exposed the gel on
X-ray film for 10-30 h.
2 Results
2.1 Isolation of wheat microspore- and pollen-specific
cDNA clones using suppression subtractive hybridization
Our primary aim is to isolate microspore-specific genes
from wheat. An efficient procedure has previously been
established for the isolation and culture of wheat
microspores and pollen grains at different developmental
stages in vitro and embryogenesis (Indrianto et al., 2001).
The development of wheat male gametophytes in vivo from
unicellular microspore to mature pollen (1-8 d) has been
observed by light and fluorescent microscopy (DAPI)
analyses, respectively. So a large and highly homogenous
population of unicellular haploid wheat microspores can
be isolated routinely, which makes molecular studies in this
important object straightforward in this experiment.
For the isolation of microspore-specific genes using SSH,
four cDNA pools were synthesised by solid-phase RT-PCR
from mRNA of freshly isolated wheat unicellular microspore
(stage A), microspore which had been starved for 2 and 4 d
(stages B2 and B4, respectively) and mature pollen (stage
C). SSH resulted in two pools: a forward pool (S), where
freshly isolated microspore (A) and mature pollen (C)
cDNAs were subtracted against cDNAs of starved
microspore (B2 and B4), and a reverse pool (R), where mixture
of B2 and B4 cDNAs were subtracted against A and C
cDNAs. More than 850 EST clones were generated by
cloning the cDNAs of the forward pool (S). Colony PCR
analysis identified about 700 clones with inserts which were
further subjected for differential screening by RNH in
macroarrays using the subtracted pools as probes. The
overwhelming majority of these clones produced a strong
signal on the membrane-bound clones when hybridized with
the forward-subtracted probe, while only few signals were
detected by hybridization with the reverse-subtracted probe.
Apparently the S pool was significantly enriched by cDNAs
which are expressed at a higher level during normal pollen
development in contrast to embryogenic microspore.
A second round of macroarray reverse Northern
hybridization (RNH) was carried out using non-subtracted
probes prepared from somatic tissue cDNA pools (leaf,
shoot and root) combined with starved microspore (B2 +
B4) cDNAs. Only a few clones showed signals, confirming
that the S pool contained ESTs which are expressed more
strongly in microspore or pollen. Hybridization of the same
clone set with a labelled probe prepared from mature pollen
showed positive signals in 90% of the clones while 89 clones
turned to be silent and were probably specific to the
microspore stage. These 89 clones were tested in a third
round of macroarray RNH with probes prepared from
unicellular microspore, mature pollen, starved microspore,
leaf, shoot, and root to confirm their microspore specificity.
In total eight clones were identified, which showed signals
only when the membrane was hybridized with RNA prepared
from unicellular microspore. DNAs of these putative
microspore-specific genes were isolated, sequenced and
analysed through the BLAST programs to search for
putative homology to known sequences. Two of the eight
clones (76 and 166) turned out to be identical, which are
completely homology with known ESTs isolated from wheat
pollen or anther cDNA library. One clone (WSM359)
showed similarity to b-expansin genes. Four others had
similarity to existing but non-functional ESTs, while
WSM158 did not reveal any significant matches to known
database entries.
2.2 Analysis of gene expression
Because preliminary trials showed that expression of
those cDNAs was too low in wheat tissues to be detected
by Northern blots with total RNA except for WSM076,
WSM359 and WSM802 clones, RT-PCR was used to iden-
tify the spatial and temporal expression pattern. The pro-
cedure enabled DNA fragments of specific size to be ampli-
fied from the seven different cDNAs. The conditions for all
RT-PCR reactions were identical. Using the individual pairs
of gene-specific primers (Table 1), RT-PCR was performed
on mRNA samples from a variety of different wheat tissues.
WSM076 mRNA was present at low level in microspore
and immature seed and accumulated at high levels in ma-
ture pollen, but undetectable in other tissues, suggesting
that this clone may be reproductive-organ or male gameto-
phyte-specific, whilst WSM719 mRNA was present at low
level in mature pollen but undetectable in other tissues
(Fig.1). WSM359 mRNA which showed high homology to
b-expansin expressed at very high level in microspore but
was undetectable in other tissues, suggesting that this gene
might be specific to unicellular microspore stages. WSM802
mRNA accumulated at very high levels in microspores and
pollen grains, and expressed at low level in immature seed,
leaf, root, stem and ovary. WSM130 mRNA expressed at
high level in mature pollen, and expressed at low level in
stem and ovary. WSM158 and WSM626 mRNA expression
was observed in mature pollen, leaf, root, stem and ovary,
but the expression level differed in tissues. Based on
JIN Yong-Feng et al.: Isolation and Expression of a Wheat Pollen-Specific Gene with Long Leader Sequence 1351
RT-PCR and Northern blots, only clone WSM359 was spe-
cific to unicellular microspore stages, while other clones
were expressed in somatic tissues or in mature pollen, too.
These results are not consistent with RNH except for
WSM359, possibly because there are more non-specific in
RNH. However, we are interested in WSM719 because it
may be pollen-specific.
2.3 Isolation of pollen-specific full-length cDNA and
sequence analysis
Therefore WSM719 was subjected to more detailed
investigation. A full-length cDNA corresponding to
WSM719 (named TaPSG719, GenBank: AY451238) was iso-
lated using 5/3 RACE techniques. The insert in the
TaPSG719 is 1 172-bp in length, which nearly agrees with
the size of 1 400-nt transcript detected in Northern blots, so
we think the cDNA should be full-length. Putative
polyadenylation signal AATAAA is presented at position
1 137. It is interesting that this cDNA sequence is rich in
SacⅠ restriction sites with five SacⅠ restriction sites pre-
senting respectively at the position 108, 253, 279, 357, 702
in the 5 leader untranslated and coding region. There is an
open reading frame of 564-bp starting with an ATG initia-
tion codon at position 330. We found an in-frame stop codon
TAA, nine nucleotides upstream from the ATG initiation
codon, so we think that this is the complete ORF (Fig.2).
The predicted protein is 188 amino acids long with a calcu-
lated molecular weight of 20 kD and a pI of 12.1. The protein
is mainly hydrophilic, containing large number of polar and
charged amino acid, except for the amino acid 60-80, which
are relatively hydrophobic. A BLAST search using the long-
est ORF revealed that this sequence did not show a signifi-
cant similarity to any genes deposited in public databases.
However, TaPSG719 showed high homology with
TaPSG719 ESTs from wheat and barley pollen and anther.
More than eleven barley EST sequence could be classified
into at least four different genes. Among eleven barley ESTs,
one EST (BQ764362) had the most striking homology with
TaPSG719 (80%).
Fig.1. RT-PCR expression analysis of wheat seven clones iso-
lated by SSH. Gene-specific primers for seven clones were used
to amplify a cDNA fragment of the corresponding gene after
reverse transcription of 10 ng of total RNA from various tissues.
Wheat GAPDH was amplified as an internal control. IS, immature
seed; L, leaf; M, microspore; O, ovary; P, mature pollen; R, root;
S, stem.
Fig.2. Nucleotide and pridected amino acid sequence of polllen-specific cDNA TaPSG719. The deduced amino acid sequence of the
largest ORF of the cDNA TaPSG719 is shown. –, the stop codon. The short uORFs in the 5 leader sequence are indicated in boldface
letters and underlined. Putative polyadenylation signal (AATAAA) is boxed.
Acta Botanica Sinica 植物学报 Vol.46 No.11 20041352
2.4 RNA analysis in pollen development
Preliminary RNA gel blot analysis about organ-specific
expression pattern revealed TaPSG719 transcripts present
only slight but evident signal in mature pollen, but was
undetectable in young seedlings and other vegetative or
other floral tissues (Fig.3A). Because the gene was only
expressed in pollen but not in other tissues, we were inter-
ested in the gametophytic expression pattern of TaPSG719
transcripts. To determine the gametophytic expression pat-
tern of TaPSG719 transcripts, total RNA was extracted from
microspore and developing pollen at eight developmental
stages (one day one stage). As a result of RT-PCR, we found
TaPSG719 transcripts were detectable on the 4th day and
increased rapidly at middle stages of pollen development
with maximum levels on the 5th day during pollen
development, and decreased during pollen maturation
(Fig.3B). Therefore, TaPSG719 is shown to be a typical
middle-late pollen-specific gene.
2.5 Genomic DNA gel blot analysis
Genomic DNA gel blot analysis was performed to deter-
mine the number of TaPSG719 gene in the wheat genome.
Southern analysis by TaPSG719 probe indicated that
TaPSG719 might be a member of a small gene family
(Fig.4). However, hybridization pattern observed could be
due to the wheat hexaploid feature. One gene copy of TAA1
genes per haploid component was found in the diploid ge-
nome (Wang et al., 2002). Gornicki et al. (1997) has found
a similar situation in wheat where the nuclear genes
encoding plastidial acetyl CoA-carboxylase genes have not
been duplicated at all or only sparingly in the case of those
coding for the cytosolic counterparts. So TaPSG719 may
not be duplicated or may be multicopy of the same gene.
2.6 Translational regulation of 5 leader sequence in-
cluding uORF
The TaPSG719 transcript has a 329-nt 5 leader
untranslated region (Fig.2). The 5 untranslated region is
considerably longer than that found in most plant genes,
which typically contain about 100 nucleotides. The 5 leader
in the TaPSG719 is unusually long for a eukaryotic mRNA.
Few known genes that are specifically expressed in the
pollen or anther have an mRNA with a 5 leader longer than
200 nt. Only the transcripts of homeobox gene ATH1
(Quaedvlieg et al.,1995 ), plastid psbD gene in Arabidopsis
(Hoffer and Christopher, 1997 ) and maize pollen Xyl gene
(Bih et al.,1999 ) have long 5 leaders of 830 nt , 950 nt and
562 nt, respectively. The predicted TaPSG719 translation
start site is not the 5 most proximal AUG in the transcript.
Furthermore, TaPSG719 lacks the AUG context consensus
sequence (caA(A/C) aAUGGCg) of monocots, which is
thought to be important for AUG codon recognition (Joshi
et al.,1997). In addition, the 329 nt 5 leader sequence
Fig.3. Specific expression of the cDNA TaPSG719 in wheat. A.
Northern blot of the TaPSG719 cDNAs.Fifteen µg of total RNA
of each sample from immature seed (IS), leaf (L), microspore
(M), ovary (O), mature pollen (P), root (R), stem (S) was hybrid-
ized with the TaPSG719 cDNA probes. B. Expression pattern of
the TaPSG719 cDNAs by RT-PCR analysis during the develop-
ment of male gametophytes in vivo from unicellular microspore to
mature tri-cellular pollen (1-8 d). Specific primers for TaPSG719
were used in PCR to amplify a cDNA fragment of the correspond-
ing gene after reverse transcription of 1 ng of total RNA from
various tissues. All amplifications were in the linear range between
27 and 41 cycles and 35 cycles were used as standard.
Fig.4. Southern hybridization analysis of wheat genomic DNA
with probes from TaPSG719. DNA samples were digested with
different restriction enzymes. After electrophoresis and blotting,
the DNA was probed with radiolabeled probes from TaPSG719.
Gene-specific fragments for probes were generated from the spe-
cific regions of the genes using PCR. E, EcoRⅤ; H, HindⅢ; P,
PstⅠ; X, XbaⅠ.
JIN Yong-Feng et al.: Isolation and Expression of a Wheat Pollen-Specific Gene with Long Leader Sequence 1353
contained six AUG codons. Translation initiation at these
sites would result in three uORF encoding putative pep-
tides of 30, 10 and 2 amino acid residues. However, no
known proteins in public database are found to be signifi-
cantly similar to the uORF peptides. The unusual length of
the leader sequence with uORFs and a poor AUG context
suggests TaPSG719 could be the subject of translational
regulation.
To investigate the influence of its 329 nucleotide leader
on the efficiency of translation, we prepared the protein by
in vitro transcription/translation of the TaPSG719 coding
region using T7 RNA polymerase and wheat germ extract.
Expression plasmids were constructed containing the in-
sert of TaPSG719 or a deletion construct in which only 27
nucleotides upstream of the putative initiation AUG were
retained and uORF was mutated, or a deletion construct
lacking the whole 5 leader sequence. First, we examined
whether three constructs transcribed equally in transcrip-
tion/translation reaction in vitro with the identical amount
of plasmid DNA. It was confirmed that the same level of
transcript was present in each reaction with different con-
structs by Northern blotting analysis using cDNA
TaPSG719 probe. In vitro transcription/translation reac-
tions were analyzed using the constructs of wild-type and
modified uORFs. A major protein band of approximately 20
kD, which is in agreement with the expected size, was ob-
served for three constructs. pHelix719-2 construct, in which
about 300 nucleotide leader sequence containing the uORFs
was deleted, resulted in about two-fold increase of
translation. While pHelix719-3 construct without the whole
5 leader sequence decreased translational efficiency com-
pared with pHelix719-2 construct, but increased compared
with translational efficiency by about one-fold compared
with wild-type construct (Fig.5). In general, the deletion
construct lacked the whole 5 leader sequence, any pro-
teins or re-initiation factors for efficient translation could
not react. Possibly the nucleotide sequence of about 30 bp
from pHelix 1(-) vector before T7 promoter might be taken
as leader sequence, which some proteins or re-initiation
factors for translation could react. However, the 329 nucle-
otide leader sequence clearly represses the translation effi-
ciency in vitro.
3 Discussion
Wheat is one of the most important crops in the world.
Very little is known about the molecular biology of its
gametophyte development despite a longstanding interest
in hybrid seeds. Much of our information is from the studies
on a few model and crop plants such as Arabidopsis,
tobacco, vegetable crops, and maize (Baltz et al., 1992;
Estruch et al.,1994; Muschietti et al.,1994; Tebbutt et al.,
1994; Brander and Kuhlemeier, 1995; Gupta et al., 2002;
Park et al., 2002; Steiner et al., 2003). There is very little
information on gene concerned specifically with pollen and
anther development in wheat with the exception of partial
EST clones for which no functional information is available.
Only one example was described about wheat gene function
during gametophyte development that three apparently
homeologous genes (TAA1a, TAA1b and TAA1c) were
characterized and expressed only at specific stages of pollen
development as the microspore wall thickened during the
progression of free microspores into vacuolated-
microspores. However, TAA1 express specifically within the
sporophytic tapetum cells but not gametophytic cells
(Wang et al., 2002).
In this study, a novel pollen-specific cDNA TaPSG719
was isolated. Search for homology using DNA and polypep-
tide databases have not resulted in any known sequence.
Northern blot and RT-PCR analyses indicated TaPSG719
transcripts were pollen-specific. TaPSG719 transcripts were
detectable on the 5th day before anthesis and increased
rapidly at middle stages of pollen development with maxi-
mum levels on the 4th day before anthesis, and decreased
Fig.5. Autoradiography of the translated products of TaPSG719.
Expression plasmids were constructed containing the insert of
TaPSG719 (lane 1) or a deletion construct in which only 27 nucle-
otides upstream of the putative initiation AUG were retained and
uORF was mutationed (lane 2), or a deletion construct lacking the
whole 5 leader sequence (lane 3). The in vitro translation reaction
was carried out without expression plasmid as negative control
(lane 4).
Acta Botanica Sinica 植物学报 Vol.46 No.11 20041354
during pollen maturation. It appears that the temporal and
spatial expression patterns of TaPSG719 are unique in the
expression of the pollen-specific genes. The development
of wheat male gametophytes in vivo as observed by light
and fluorescent microscopy (DAPI) analyses indicated im-
mature pollen on the 4th day before anthesis have com-
pleted mitosis. The strict correlation between the expres-
sion pattern of pollen-specific TaPSG719 and the predicted
male-specific components makes plausible the attractive
hypothesis that TaPSG719 is part of the biosynthetic path-
way related to exine synthesis. However, further experi-
mental work has to be carried out to identify its function.
Pollen-specific genes may be conserved at the DNA
level across diverse taxa (Treacy et al., 1997). For example,
microspore-specific gene NTM19 from tobacco could
strongly hybridize with Petunia hybrida and monocot Tra-
descantia virginana, but not show any signal in the Bras-
sica oleracea and Verbascum thapsus (Oldenhof et al.,
1996). Other genes may be restricted to a single family of
plants. The Bcp1 gene from B. rapa was found to encode
transcripts that were only present in the member of the
Brassicacea family (Theerakulpisut et al., 1991). Similarly,
anther pollen-specific gene Bnm1 from B. napus appears to
be restricted to Brassicacea family, but were not present in
all tribes of the Brassicacea family ( Joshi et al., 1997). An-
ther late pollen-expressed gene encoding a receptor-like
kinase was restricted to members of the Solanaceae family
(Mu et al., 1994). Searches for homology using DNA and
polypeptide databases indicated both of TaPSG719 did
not show a significant similarity to any genes deposited in
the public database, including dicot Arabidopsis and mono-
cot rice. Additionally, no ESTs from other species except
wheat and barley show high homology with TaPSG719,
which makes likely that TaPSG719 protein is species-spe-
cific and only functions in wheat and very closely related
species.
The 5 UTR of a gene often can affect gene expression
and frequently does via translation control (Stripecke
et al., 1994). Many stages of gamete development in plant
and animal species proceed almost without transcriptional
activity and depend mainly upon translation of
presynthesized mRNAs. Thus, in these species, transla-
tional control of gene expression is very important for ga-
mete development. Despite the importance of translational
control in the contribution of sexual reproduction, little at-
tention has been paid to elucidate the mechanisms under-
lying post-transcriptional regulation of pollen gene expres-
sion (Op den Camp and Kuhlemeier, 1998; Hulzink et al.,
2002). Many mRNA species from different eukaryotic sys-
tems can be modulated in their translation efficiency by the
present of the uORFs, the secondary structure or other
signal of the 5 untranslated sequence, or just their length
(Curie and McCormick, 1997; Hulzink et al., 2002). In these
cases, translation has often been found to be regulated at
the level of translation initiation. This led to the hypothesis
that specific sequences within the 5 or 3 UTR might play
an important role in the efficient induction of translation
during pollen development. Features associated with the 5
end of TaPSG719 transcripts raise the possibility that they
may undergo translational regulation. The TaPSG719 tran-
script is predicted to have a long 5 untranslated region (329
bp), a uORF, and poor AUG context around the TaPSG719
start site. Many genes identified as having a poor AUG
context in higher plants correspond to tightly regulated
proteins, including transcription factors, signal transducers,
regulatory proteins, metabolic enzymes, cell wall, and stress
proteins (Joshi et al., 1997). Similarly, AUG-containing
leader sequences are often found in mRNA encoding criti-
cal regulatory proteins, such as growth factor, transcrip-
tion factors and receptor proteins (Gallie, 1993). Although
the presence of uORFs is rare, there are several examples of
plant transcripts during pollen development that contain
long leader sequence and uORFs including DEX1 (Paxson-
Sowders et al., 2001), which encode a gene essential for
early pollen wall formation in Arabidopsis, and the maize
Xyl (Bih et al.,1999) . The Xyl was isolated from maize pol-
len with a 562-nucleotide 5 leader, a 54-nt sequence encod-
ing a putative signal peptide, a 933-nt coding sequence,
and a 420-nt 3-untranslated sequence (Bih et al., 1999).
The unusually long 5 leader had an open reading frame
encoding a putative 175-residue protein and could poten-
tially form many hairpin secondary structures. In addition,
OPAQUE2 encoding a maize transcription factor, the maize
Lc transcriptional activator, and Arabidopsis homeobox
gene (ATH1) encoding transcriptional activator possess
long 5 untranslated regions containing uORFs, and appear
to undergo translational regulation (Geballe and Sachs,
2002). So TaPSG719 gene described in this paper possibly
encodes critical regulatory protein in wheat and will be use-
ful for studying the molecular and regulation basis of pol-
len development, although we have no information about
the function of the protein.
Acknowledgements: We are grateful to Alisher Touraev,
Alisher S. Tashpulatov and Erwin Heberle-Bors (Institute
of Microbiology and Genetics, Vienna University) for their
advice and technical assistance.
JIN Yong-Feng et al.: Isolation and Expression of a Wheat Pollen-Specific Gene with Long Leader Sequence 1355
References:
Albani D, Robert L S, Donaldson P A, Altosaar I, Arnison P G,
Fabijanski S F. 1990. Characterization of a pollen-specific
gene family from Brassica napus which is activated during
early microspore development. Plant Mol Biol, 15: 605-622.
Albani D, Altosaar I, Arnison P G, Fabijanski S F. 1991. A gene
showing sequence similarity to pectin esterase is specifically
expressed in developing pollen of Brassica napus. Sequences
in its 5 flanking region are conserved in other pollen-specific
promoters. Plant Mol Biol, 16: 501-513.
Baltz R, Domon C, Pillay D T, Steinmetz A. 1992. Characteriza-
tion of a pollen-specific cDNA from sunflower encoding a
zinc finger protein. Plant J, 2: 713-721.
Bih F Y, Wu S S H, Ratnayake C, Walling L L, Nothnagel E A,
Huang A H C. 1999. The predominant protein on the surface
of maize pollen is an endoxylanase synthesized by a tapetum
mRNA with a long 5 leader. J Biol Chem, 274: 22884-22894.
Brander K A, Kuhlemeier C. 1995. A pollen-specific DEAD-box
protein related to translation initiation factor eIF-4A from
tobacco. Plant Mol Biol, 27: 637-649.
Charbonnel-Campaa L, Lauga B, Combes D. 2000. Isolation of a
type 2 metallothionein-like gene preferentially expressed in
the tapetum in Zea mays. Gene, 254: 199-208.
Curie C, McCormick S. 1997. A strong inhibitor of gene expres-
sion in the 5 untranslated region of the pollen-specific Lat59
gene of tomato. Plant Cell, 9: 2025-2036.
Diatchenko L, Lau Y F, Campbell A P, Chenchik A, Moqadam F,
Huang B, Lukyanov S, Lukyanov K, Gurskaya N, Sverdlov E
D, Siebert P D. 1996. Suppression subtractive hybridization:
a method for generating differentially regulated or tissue-
specific cDNA probes and libraries. Proc Natl Acad Sci USA,
93: 6025-6030.
Dickinson H G. 1994. The regulation of alternation of generation
in flowering plants. Biol Rev, 69: 419-442.
Estruch J J, Kadwell S, Merlin E, Crossland L. 1994. Cloning and
characterization of a maize pollen-specific calcium-dependent
calmodulin-independent protein kinase. Proc Natl Acad Sci
USA, 91: 8837-8841.
Fourgoux-Nicol A, Drouaud J, Haouazine N, Pelletier G, Guerche
P. 1999. Isolation of rapeseed genes expressed early and spe-
cifically during development of the male gametophyte. Plant
Mol Biol, 40: 857-872.
Gallie D R. 1993. Post-transcriptional regulation of gene expres-
sion in plants. Annu Rev Plant Physiol Plant Mol Biol, 44: 77-
105.
Geballe A P, Sachs M S. 2002. Translational control by upstream
open reading frame. Sonenberg N, Hershey J W B, Mathews
M B. Translational Control of Gene Expression. Beijing:
Tsinghua University Press. 595-614.
Gornicki P, Faris J, King I, Podkowinski J, Gill B, Haselkorn R.
1997. Plastid-localized acetyl-CoA carboxylase of bread wheat
is encoded by a single gene on each of the three ancestral
chromosome sets. Proc Natl Acad Sci USA, 94: 14179-14184.
Gupta R, Ting J T, Sokolov L N, Johnson S A, Luan S. 2002. A
tumor suppressor homolog, AtPTEN1, is essential for pollen
development in Arabidopsis. Plant Cell, 14: 2495-2507.
Hoffer P H, and Christopher D A. 1997, Structure and blue-light-
responsive transcription of a chloroplast psbD promoter from
Arabidopsis thaliana. Plant Physiol, 115: 213-222.
Hulzink R J M, de Groot P F M, Croes A F, Quaedvlieg W, Twell
D, Wullems G J, van Herpen M. 2002. The 5-untranslated
region of the ntp303 gene strongly enhances translation during
pollen tube growth, but not during pollen maturation. Plant
Physiol, 129: 342-353.
Indrianto A, Barinova A, Touraev A, Heberle-Bors E. 2001.
Tracking individual wheat microspores in vitro: identification
of embryogenic microspores and body axis formation in the
embryo. Planta, 212: 163-174.
Joshi C P, Zhou H, Huang X, Chiang V L. 1997. Context se-
quences of translation initiation codons in plants. Plant Mol
Biol, 35: 993-1001.
Kapoor S, Kobayashi A, Takatsuji H. 2002. Silencing of the tape-
tum-specific zinc finger gene TAZ1 causes premature degen-
eration of tapetum and pollen abortion in Petunia. Plant Cell,
14: 2353-2367.
Martinez-Garcia J F, Moyano E, Alcocer M J, Martin C. 1998.
Two bZIP proteins from Antirrhinum flowers preferentially
bind a hybrid C-box/G-box motif and help to define a new
sub-family of bZIP transcription factors. Plant J, 13: 489-
505.
Mascarenhas J P. 1993. Molecular mechanisms of pollen tube
growth and differentiation. Plant Cell, 5: 1303-1314.
McCormick S. 1993. Male gametophyte development. Plant Cell,
5: 1265–1275.
Mu J H, Lee H S, Kao T H. 1994. Characterization of a pollen-
expressed receptor-like kinase gene of Petunia inflata and the
activity of its encoded kinase. Plant Cell, 6: 709-721.
Muschietti J, Dircks L, Vancanneyt G, McCormick S. 1994.
LAT52 protein is essential for tomato pollen development:
Pollen expressing antisense LAT52 RNA hydrates and germi-
nates abnormally and cannot achieve fertilization. Plant J, 6:
321–338.
Oldenhof M T, de Groot P F, Visser J H, Schrauwen J A, Wullems
G J. 1996. Isolation and characterization of a microspore-
specific gene from tobacco. Plant Mol Biol , 31: 213-225.
Op den Camp R G L, Kuhlemeier C. 1998. Phosphorylation of
tobacco eukaryotic translation initiation factor 4A upon
Acta Botanica Sinica 植物学报 Vol.46 No.11 20041356
pollen tube germination. Nucleic Acids Res, 26: 2058-2062.
Park B S, Park Y D, Kim H U, Jin Y M, Kim H I. 2002. BAN103,
a pollen-preferential gene, from Chinese cabbage and its pro-
moter activity. Mol Cell, 14: 150-157.
Paxson-Sowders D M, Dodrill C H, Owen H A, Makaroff C A.
2001. DEX1, a novel plant protein, is required for exine pat-
tern formation during pollen development in Arabidopsis. Plant
Physiol, 127: 1739-1749.
Quaedvlieg N, Dockx J, Rook F, Weisbeek P, Smeekens S. 1995.
The homeobox gene ATH1 of Arabidopsis is derepressed in
the photomorphogenic mutants cop1 and det1. Plant Cell, 7:
117-129.
Roberts M R, Foster G D, Blundell, R P, Robinson, S W, Kumar
A, Draper J, Scott R. 1993. Gametophytic and sporophytic
expression of an anther-specific Arabidopsis thaliana gene.
Plant J , 3: 111-120.
Steiner C, Bauer J, Amrhein N, Bucher M. 2003. Two novel genes
are differentially expressed during early germination of the
male gametophyte of Nicotiana tabacum. Biochim Biophys
Acta, 1625: 123-133.
Stripecke R, Oliveira C C, McCarthy J E, Hentze M W. 1994.
(Managing editor: ZHAO Li-Hui)
Proteins binding to 5 untranslated region sites: a general mecha-
nism for translational regulation of mRNAs in human and
yeast cells. Mol Cell Biol, 14: 5898-5909.
Taylor L P, Hepler P K. 1997. Pollen germination and tube growth.
Annu Rev Plant Physiol Plant Mol Biol, 48: 461-491.
Tebbutt S J, Rogers H J, Lonsdale D M. 1994. Characterization
of a tobacco gene encoding a pollen-specific polygalacturonase.
Plant Mol Biol, 25: 283-297.
Theerakulpisut P, Xu H, Singh M B, Pettitt J M, Knox R B.
1991. Isolation and developmental expression of Bcp1, an
anther-specific cDNA clone in Brassica campestris. Plant Cell,
3: 1073-1084.
Treacy B K, Hattori J, Prud’homme I, Barbour E, Boutilier K,
Baszczynski C L, Huang B, Johnson D A, Miki B L. 1997.
Bnm1, a Brassica pollen-specific gene. Plant Mol Biol, 34:
603-611.
Wang A, Xia Q, Xie W, Dumonceaux T, Zou J, Datla R, Selvaraj
G. 2002. Male gametophyte development in bread wheat
(Triticum aestivum L.): molecular, cellular, and biochemical
analyses of a sporophytic contribution to pollen wall
ontogeny. Plant J, 30: 613-623.