全 文 ：Received 16 Jul. 2003 Accepted 13 Feb. 2004
Supported by the National Natural Science Foundation of China (30170597).
http://www.chineseplantscience.com
Acta Botanica Sinica
植 物 学 报 2004, 46 (6): 738-743
Identification of Amino Acids of Cladosporium fulvum CfHNNI1
Required for Function of Necrosis Induction in Plants
CAI Xin-Zhong
(Institute of Biotechnology, Department of Plant Protection, Zhejiang University, Hangzhou 310029, China)
Abstract: Nonhost resistance is durable and broad-spectrum, which attracts more and more attention
for its great potential to be exploited in crop protection against diseases. However, mechanism of nonhost
resistance is largely unknown. Previously a cDNA clone of tomato leaf mould pathogen Cladosporium
fulvum Cooke was isolated. It is highly homologous in sequence to bZIP transcription factors. Upon expression
it results in necrosis in its host tomato (Lycopersicon esculentum Mill.) and nonhost Nicotiana spp. and
confers resistance to potato virus X, and thus is named CfHNNI1 (C. fulvum host and nonhost necrosis
inducer 1). The present paper reports the results on mutational analyses of the relationship between the
amino acid sequences of putative DNA-binding and leucine zipper domains of CfHNNI1 and the necrosis-
inducing function of CfHNNI1. Deletion of six amino acids R112-N117 (RKRQRN) or substitution of alanines
for arginines R125 and R127 of DNA-binding domain almost completely abolished or severely lowered the
necrosis-inducing activity of CfHNNI1, while substitution of alanines for leucine L149 or L163 of leucine
zipper domain partially impaired the necrosis-inducing activity of CfHNNI1. Adding of tobacco PR-1a signal
peptide to CfHNNI1 so that the mature product CfHNNI1 was secreted into extracellular compartment
resulting in complete loss of the necrosis-inducing activity. It was concluded that amino acids R112-N117,
R125 and R127, L149 and L163 of putative DNA-binding and leucine zipper domains of CfHNNI1 and inner
cellular localization of mature protein were required for full necrosis-inducing function of CfHNNI1.
Key words: CfHNNI1; necrosis; mutational analysis; bZIP transcription factor; inner cellular localization;
Cladosporium fulvum ; nonhost resistance
A plant species is resistant to the majority of potential
pathogens, which is so called nonhost resistance. It is the
most common form of plant disease resistance (Heath, 2000).
Nonhost resistance is durable and broad-spectrum, thus is
of high potential of exploitation in plant protection against
diseases. Mechanism of nonhost resistance is still poorly
understood. Both plant and pathogen components are
involved in determination of host and nonhost interactions.
The plant components include performed defense factors
such as performed peptides, proteins and non-
proteinaceous secondary metabolisms, and induced
defense gene activation, accumulation of reactive oxygen
species and hypersensitive response (HR) in some cases
(Kamoun et al., 1999; Heath, 2000; Lu et al., 2001), while
the pathogenic factors involved in determination of
nonhost interaction include Avr, Hrp, and some other
components that triggered plant defense responses through
interaction with plant components (Kamoun et al., 1999;
Heath, 2000).
Previously in an effort to isolate HR inducers, a clone
was retrieved from a PVX-based screen of a cDNA library
derived from Cladosporium fulvum race 5 (Takken et al.,
2000). Upon functional expression this gene induces a fast
and severe hypersensitive necrosis in its host tomato and
nonhost Nicotiana spp. (Takken et al., 2000), and confers
resistance to potato virus X, thus it is named CfHNNI1 (C.
fulvum host and nonhost necrosis inducer 1). Therefore
CfHNNI1 attracts our attention for its potential of exploita-
tion in plant protection against diseases through the strat-
egy of engineering plants in which CfHNNI1 is expressed
under the control of pathogen-inducible promoter. A pre-
requisite to fulfil it is to understand the mechanisms of
CfHNNI1 to induce hypersensitive necrosis and disease
resistance. This paper reports the results on mutational
analyses of the relationship between inner cellular localiza-
tion of mature protein, the amino acid sequences of puta-
tive DNA-binding and leucine zipper domains of CfHNNI1
and the necrosis-inducing function of CfHNNI1.
1 Materials and Methods
1.1 Plasmids
Binary plasmids pRH91.13::CfHNNI1, pRH366.5::Avr4
and pRH312.25::Avr4 were provided by Renier van der
Hoorn, Wageningen University, The Netherlands. All
CAI Xin-Zhong: Identification of Amino Acids of Cladosporium fulvum CfHNNI1 Required for Function of Necrosis Induction
in Plants 739
plasmids contain 35S promoter of cauliflower mosaic virus
( 3 5 S ) a n d s e q u e n c e e n c o d i n g n e o m y c i n
phosphotransferase Ⅱ (NptⅡ) that confers resistance to
kanamycin. In addition pRH312.25::Avr4 contains the se-
quence coding signal peptide of tobacco PR-1a (SP). Mu-
tated CfHNNI1 sequences were substituted for the inserts
between 35S and NptⅡ of plasmids pRH91.13::CfHNNI1
and pRH366.5::Avr4, and the insert between SP and NptⅡ
of plasmid pRH312.25::Avr4, to release the binary plasmids
with mutated CfHNNI1 for Agrobacterium-mediated tran-
sient transformation in tobacco plants. Structures of these
plasmids are shown in Fig.1.
1.2 CfHNNI1 mutant constructions for transient
transformation
pRH91.13::CfHNNI1 was digested with SalⅠ and EcoRⅠ to
release the CfHNNI1 ORF, which was ligated to XhoⅠ -
and EcoRⅠ-digested pRH366.5::Avr4 and pRH312.25::Avr4
so that the CfHNNI1 ORF was substituted for the Avr4
ORF to obtain pRH366.5::CfHNNI1 and pRH312.25::
CfHNNI1 respectively. The only difference between the
two constructs is that signal peptide sequence of tobacco
PR-1a was inserted before the ORF of CfHNNI1 in
pRH312.25::CfHNNI1 but not in pRH366.5::CfHNNI1
(Fig.1). These constructs were used to identify whether
cellular localization is required for necrosis-inducing activ-
ity of CfHNNI1.
PCR-based strategy was employed to make the mutated
CfHNNI1 constructs for structure and function assay. The
PCR primers used in this assay are listed in Table 1. The
primers were designed in the way that they consist of two
Fig.1. Construction maps of plasmids containing mutated CfHNNI1 and plasmids used for making them. Avr4, ORF of Avr4; CfHNNI1,
ORF and polyadenylation region of CfHNNI1; LB/RB, left border and right border of T-DNA; mCfHNNI1, mutated constructs of
CfHNNI1 (see text and Table 2); NptⅡ, sequence encoding neomycin phosphotransferase Ⅱ; PI, polyadenylation region of sequence
encoding potato proteinase inhibitor Ⅱ; 35S, 35S promoter of cauliflower mosaic virus; SP, signal peptide sequence of tobacco PR-1a.
Table 1 PCR primers used for making CfHNNI1 mutant constructs
Primer Sequence（5→ 3）
ATTA43-7GF CGCGTCGACTATGGCCGGGGGATACTTCACC
ATTA43-7GR CGGAATTCCGGCGGACGATGCGGCCGCGG
dnad1F GGCTCAGGCTCGAGCAAGATCACCGAAGCGGCCCGTCGATAC
dnad1R GTATCGACGGGCCGCTTCGGTGATCTTGCTCGAGCCTGAGCC
dnam1F TCCGCAAGAGACAACGTGCCACCGAAGCGGCCCGTCGAATAC
dnam1R GACGGGCCGCTTCGGTGGCACGTTGTCTCTTGCGGATCTTG
dnam2F CCGTCGATACGCCCAAGCGAAGTTGGATAGGGCCTCAGAGC
dnam2R CCTATCCAACTTCGCTTGGGCGTATCGACGGGCCGCTTCGGT
lzm1F GGATAGGGCCTCAGAGGCCGAGGAAGCTTTGGAAGCCATGG
lzm1R GCTTCCAAAGCTTCCTCGGCCTCTGAGGCCCTATCCAACTTC
lzm2F GGTAAAGAGCGAGATGAAGCTAGGTTGAAGCTTGCCAAGGC
lzm2R CCTTGGCAAGCTTCAGCCTAGCTTCATCTCGCTCTTTACCCATGG
lzm3F CCGAGGCTGGTGTCGCGCGAGGGTTGGTTGGGAAGTAG
lzm3R CTTCCCAACCAACCCTCGCGCGACACCAGCCTCGGTTTCAGA
Underlined sequences are digestion sites of restriction enzymes included in some primers for facilitating cloning of PCR products (SalⅠ, 5-
GTCGAC-3； EcoRⅠ, 5-GAATTC-3). Bolded are alanine codon sequences substituting for N117 in dnam1, R125 and R127 in dnam2, L135
in lzm1, L149 in lzm2 and L163 in lzm3, respectively.
Acta Botanica Sinica 植物学报 Vol.46 No.6 2004740
parts of CfHNNI1 sequences of which half was upstream
and half was downstream the deletion or mutation
sequences. Mutated sequences encoding alanine were in-
cluded as well in the middle of the two parts of CfHNNI1
sequence in case of point mutation constructs (Table 1).
The forward primers (dnad1F, dnam1F, dnam2F, lzm1F,
lzm2F and lzm3F are shown in Table 1) and ATTA43-7GR,
reverse primers (dnad1R, dnam1R, dnam2R, lzm1R, lzm2R
and lzm3R are shown in Table 1) and ATTA43-7GF,
respectively, were used as primer pairs together with the
template of pRH91.13::CfHNNI1 to amplify the downstream
half and upstream half of mutated CfHNNI1s, which were
then used as templates together with primer pairs ATTA43-
7GF/ATTA43-7GR to amplify the complete mutated
CfHNNI1s, respectively. The resulting CfHNNI1 mutants
were digested with SalⅠ and EcoRⅠ which were included
in the primers ATTA43-7GF and ATTA43-7GR, respectively,
then ligated to XhoⅠ - and EcoRⅠ -digested pRH366.5::
Avr4 to substitute for the ORF of Avr4.
1.3 Agrobacterium transformation and plant leaf infil-
tration
The binary plasmids containing the mutated CfHNNI1
constructs were introduced through electroporation into
competent Agrobacterium tumefaciens cells with a Gene
Pulser Ⅱ (Bio-Rad, USA). The liquid cultures of resulting
Agrobacterium were infiltrated into sectors of tobacco
leaves with disposable syringes without needle as de-
scribed previously (Cai and Xu, 2003). This agroinfiltration
assay was performed four times. Necrosis-inducing activ-
ity of the constructs is depicted as percentage of necrotic
area of the total infiltrated region with mean value ± stan-
dard variation. Significance of difference between data of
treatments was checked by Duncan’s SSR test (Hu and
Zhang, 1985).
All other DNA manipulation was conducted with stan-
dard procedures (Sambrook et al., 1989).
2 Results
2.1 CfHNNI1 is a putative bZIP transcription factor
A BLASTX search revealed that CfHNNI1 has high
homology with bZIP transcription factor including JUN of
Avian sarcoma virus 17 (Maki et al., 1987), FOS-related
antigen (FRA) of Drosophila melanogaster (DmFRA)
(Perkins et al., 1990) and GCN4 of Saccharomyces cerevisiae
(Hinnenbusch, 1984). The highest homology was found in
the basic DNA binding- and leucine zipper domains.
Alignment of nearly 20 sequences of bZIPs from a variety
of species of plant, animal and microorganisms
demonstrated that at full-length sequence level, it is most
similar to DmFRA (Fig.2). The bZIP transcription factors
comprise a family of proteins containing a basic region that
mediates the sequence-specific DNA-binding and a leucine
zipper required for dimerization. Members of this family are
involved in transcriptional activation of a wide variety of
genes. Like other eukaryotic bZIP transcription factors,
CfHNNI1 includes a putative DNA-binding domain rich of
basic amino acid residues and a leucine zipper domain
containing five leucine or its similar amino acid residues
separated by six other residues (Fig.2).
2.2 Mutational analysis of the putative DNA-binding and
leucine zipper domain of CfHNNI1 protein
To investigate whether a functional DNA-binding and
leucine zipper domain is required for necrosis-inducing
activity of CfHNNI1, six mutants were made with mutations
in amino acids important in function and highly conserved
in reported bZIP transcription factors. Two point mutations
in codons for conserved amino acids (N117, R125 and R127)
and a small deletion (R112-N117 (RKRQRN)) were
introduced in the putative DNA-binding domain while three
point mutations in conserved leucines (L135, L149 and L163)
were made in the sequence encoding for the leucine zipper
domain. All six constructs were inserted into a binary vector,
behind the CaMV35S promoter (Fig.1, pRH366.5::
mCfHNNI1) and examined for necrosis-inducing activity
by Agrobacterium-mediated approach (agroinfiltration) on
tobacco. As shown in Fig.3 and Table 2, expression of
CfHNNI1, as well as positive control (coexpression of Avr4/
Cf-4), led to full necrosis (Cai and Xu, 2003) while expression
of CfHNNI1D79, a loss-of-function mutant with the deletion
of 5 79 bp (Cai et al., submitted for publication), and the
negative control (expression of Cf-4), did not result in any
necrosis in infiltrated area. Deletion of six amino acids R112-
N117 completely abolished the necrosis-inducing activity
of CfHNNI1, substitution of alanine for R125 and R127
lowered by about 75% while substitution of alanine for
N117 did not affect the necrosis-inducing activity of
CfHNNI1. Substitution of alanine for L149 or L163 of leucine
zipper domain impaired by about 30% the necrosis-inducing
activity of CfHNNI1 while mutation of L135 into alanine
made no difference in the necrosis-inducing activity of
CfHNNI1.
These data indicate that the DNA-binding domain is
essential, and the leucine zipper domain is important for full
necrosis-inducing activity of CfHNNI1.
2.3 Putative extracellular targeting of the mature protein
abolished the necrosis-inducing activity of CfHNNI1
Tobacco PR-1a signal peptide was reported to be
functional to target the fused protein other than PR-1a such
CAI Xin-Zhong: Identification of Amino Acids of Cladosporium fulvum CfHNNI1 Required for Function of Necrosis Induction
in Plants 741
Figs. 3-4. 3. Necrosis-inducing activity of CfHNNI1 mutated in the putative DNA-binding and leucine zipper domains. Leaf sectors
of tobacco plants were infiltrated with liquid culture of Agrobacterium transformed with binary vectors containing a variety of mutated
CfHNNI1s listed in Table 2. The photographs were taken 7 d post infiltration. 4. CfHNNI1 with tobacco PR-1a signal peptide lost the
activity to induce necrosis in plant. Sectors of left and right leaves of tobacco plants were infiltrated with liquid culture of Agrobacterium
transformed with binary vectors containing CfHNNI1 without and with tobacco PR-1a signal peptide sequence respectively. The
photographs were taken 7 d post infiltration.
Fig.2. Alignment of deduced amino acid sequences between Cladosporium fulvum CfHNNI1 and Drosophila melanogaster DmFRA.
Identical, highly similar and lowly similar amino acids are shown as *, : and . respectively. Amino acids of the putative DNA-binding
domain are shaded while leucines conserved in leucine zipper domain of bZIP transcription factors are underlined. GenBank accession
numbers of D. melanogaster DmFRA and C. fulvum CfHNNI1 are A35847 and AJ277438 respectively.
Acta Botanica Sinica 植物学报 Vol.46 No.6 2004742
as Avr9 into extracellular space (Hammond-Kosack et al.,
1994). To investigate whether cellular localization is required
for necrosis-inducing activity of CfHNNI1, tobacco PR-1a
signal peptide sequence was added to CfHNNI1 so that
the mature product CfHNNI1 was directed to secret into
extracellular compartment. The mutant construct was
inserted into a binary vector, and examined for necrosis-
inducing activity by agroinfiltration on tobacco. As shown
in Fig.4, the mutation completely abolished the necrosis-
inducing activity of CfHNNI1, indicating that inner cellular
localization of mature protein might be prerequisite for
necrosis-inducing function of CfHNNI1.
3 Discussion
Induction of plant hypersensitive necrosis and disease
resistance by a bZIP transcription factor of a pathogen has
not yet been reported. Therefore it is intriguing to identify
whether CfHNNI1 is a bZIP transcription factor. This re-
port provided three lines of evidence for the possibility of
CfHNNI1 to be a bZIP transcription factor. Firstly, CfHNNI1
contains a region with high homology to DNA-binding and
leucine zipper domains of a bZIP transcription factor.
Secondly, some amino acids of CfHNNI1 in these domains
conserved and functionally important in bZIP transcrip-
tion factors were essential for its necrosis-inducing function.
Thirdly, putative inner cellular localization of mature protein,
which is one of the characteristics of bZIP transcription
factors, was prerequisite for necrosis-inducing function of
CfHNNI1. Nevertheless, DNA-binding activity and rela-
tionship between the putative DNA-binding and leucine
zipper domains and DNA-binding function through gel
mobility shift assay will be required to confirm whether
CfHNNI1 is indeed a bZIP transcription factor.
References:
Cai X-Z, Xu Y-P. 2003. Regulatory effect of salicylic acid and
ethylene on Cf-dependent hypersensitive necrosis. J Plant
Physiol Mol Biol , 29: 11-14. (in Chinese with English abstract)
Hammond-Kosack K, Harrison K, Jones J. 1994. Developmen-
tally regulated cell death on expression of the fungal avirulence
gene Avr9 in tomato seedlings carrying the disease-resistance
gene Cf-9. Proc Natl Acad Sci USA, 91: 10445-10449.
Heath M C. 2000. Nonhost resistance and nonspecific plant
responses. Curr Opin Plant Biol, 3: 315-319.
Hinnebusch A G. 1984. Evidence for transcriptional regulation of
the activator of general amino acid control in yeast. Proc Natl
Acad Sci USA, 81: 6442-6446.
Hu B-M , Zhang Q-D. 1985. Statistical and Analyses Methods of
Agricultural Tests. Hangzhou: Zhejiang Science and Technol-
ogy Publisher. 82-84. (in Chinese)
Kamoun S, Huitema E, Vleeshouwers V. 1999. Resistance to
oomycetes: a general role for the hypersensitive response.
Trends Plant Sci, 4: 196-200.
Lu M, Tang X, Zhou J. 2001. Arabidopsis NHO1 is required for
general resistance against Pseudomonas bacteria. Plant Cell,
13: 437-447.
Maki, Y, Bos T J, Davis C, Starbuck M, Vogt P K. 1987. Avian
sarcoma virus 17 carries the jun oncogene. Proc Natl Acad Sci
USA, 84: 2949-2852.
Perkins K K, Admon A, Patel N, Tjian R. 1990. The Drosophila
Fos-related AP-1 protein is a developmentally regulated tran-
scription factor. Genes Dev, 4: 822-834.
Sambrook J, Fritsch E F, Maniatis T. 1989. Molecular Cloning: a
Laboratory Manual. 2nd ed. New York: Cold Spring Harbour
Laboratory Press.
Takken F, Luderer R, Gabriels S, Westerink N, de Wit P, Joosten
Table 2 Agroinfiltration assay of binary vectors containing various mutated constructs of CFHNNI1 on tobacco
Constructs Necrosis-inducing activity (%)
Cf-4 (negative CK1) 0 ± 0 A
CfHNNI1D79 (negative CK2) 0 ± 0 A
Avr4/Cf-4 (co-infiltration) (positive CK1) 100 ± 0 B
CfHNNI1 (positive CK2) 100 ± 0 B
Mutants of DNA-binding domain (R112-R131):
dnad1: DR112-N117 (RKRQRN) 5 ± 2 A
dnam1: N117→A 100 ± 0 B
dnam2: R125→A, R127→A 75 ± 10 C
Mutants of Leucine zipper domain (A132-K169)
lzm1: L135→A 100 ± 0 B
lzm2: L149→A 70 ± 8 C
lzm3: L163→A 70 ± 10 C
Necrosis-inducing activity of the constructs is depicted as percentage of necrotic area of the total infiltrated region (see also Fig.3) with mean
value of four experiments ± standard variation. Significance of difference between data of treatments was checked by Duncan’s SSR test
(a = 0.01).